Potential impact of efflux pump genes in mediating rifampicin resistance in clinical isolates of Mycobacterium tuberculosis from India
Authors:
Anshika Narang aff001; Kushal Garima aff001; Shraddha Porwal aff001; Archana Bhandekar aff001; Kamal Shrivastava aff001; Astha Giri aff001; Naresh Kumar Sharma aff001; Mridula Bose aff001; Mandira Varma-Basil aff001
Authors place of work:
Department of Microbiology, Vallabhbhai Patel Chest Institute, University of Delhi, Delhi, India
aff001
Published in the journal:
PLoS ONE 14(9)
Category:
Research Article
doi:
https://doi.org/10.1371/journal.pone.0223163
Summary
Despite the consideration of chromosomal mutations as the major cause of rifampicin (RIF) resistance in M. tuberculosis, the role of other mechanisms such as efflux pumps cannot be ruled out. We evaluated the role of four efflux pumps viz., MmpL2 (Rv0507), MmpL5 (Rv0676c), Rv0194 and Rv1250 in providing RIF resistance in M. tuberculosis. The real time expression of the efflux pumps was analyzed in 16 RIF resistant and 11 RIF susceptible clinical isolates of M. tuberculosis after exposure to RIF. Expression of efflux pumps in these isolates was also correlated with mutations in the rpoB gene and MICs of RIF in the presence and absence of efflux pump inhibitors. Under RIF stress, Rv0194 was induced in 8/16 (50%) RIF resistant and 2/11 (18%) RIF susceptible isolates; mmpL5 in 7/16 (44%) RIF resistant and 1/11 (9%) RIF susceptible isolates; Rv1250 in 4/16 (25%) RIF resistant and 2/11 (18%) RIF susceptible isolates; and mmpL2 was upregulated in 2/16 (12.5%) RIF resistant and 1/11 (9%) RIF susceptible isolates. This preliminary study did not find any association between Rv0194, MmpL2, MmpL5 and Rv1250 and RIF resistance. However, the overexpression of Rv0194 and mmpL5 in greater number of RIF resistant isolates as compared to RIF susceptible isolates and expression of Rv0194 in wild type (WT) resistant isolates suggests a need for further investigations.
Keywords:
Gene expression – Mutation – Hyperexpression techniques – tuberculosis – Extensively drug-resistant tuberculosis – India – RNA isolation
Introduction
Rifampicin (RIF), one of the most important first-line anti-tuberculosis (TB) drugs, is a key factor in determining the effectiveness of treatment regimens [1, 2]. Since, more than 90% of RIF resistant strains are also resistant to isoniazid (INH), RIF resistance is used as a valuable surrogate marker for multidrug resistant (MDR) TB [3, 4]. The RIF resistant phenotype, in approximately 95% of the cases, is caused by spontaneous mutations, mostly located in the 81-bp core region (codons 507 to 533) of the rpoB gene, called the RIF resistance-determining region (RRDR) [5, 6]. However, in approximately 5% of clinical RIF resistant M. tuberculosis isolates, no mutations are found in the RRDR [7]. Absence of mutations in these isolates gives reasonable evidence on the role of other mechanisms in development of RIF resistance.
Other than mutations in the RRDR, resistance to RIF in M. tuberculosis could also be due to mutations in new, as yet unidentified loci, alteration in the target, change in drug permeability [8, 9], or involvement of efflux pumps which export various molecules outside the bacterial cell. The design of new therapeutic strategies may depend on the characterization of these efflux pumps. A few putative efflux pumps (viz. Rv1258c, Rv1410c, Rv1819c, PstB, Rv2936, Rv0783) have been observed to play a role in RIF resistance in M. tuberculosis [10, 11, 12, 13], however, the role of several other efflux pumps in RIF resistance still needs to be elaborated.
In the present study, we have explored the role of efflux pumps MmpL5, Rv1250, MmpL2 and Rv0194 in resistance to RIF by studying the expression of the genes encoding these membrane transporters under RIF stress, in M. tuberculosis isolates obtained from patients of pulmonary tuberculosis. The present study attempts to provide an insight into RIF resistance mechanisms in addition to chromosomal mutations.
Methodology
Ethics statement
Written informed consent and detailed history of contact were taken from each patient prior to the collection of samples, following approval of the study by the Institutional Ethics Committee of Vallabhbhai Patel Chest Institute.
Bacterial strains and growth conditions
Clinical isolates (n = 130) of M. tuberculosis and the reference strain H37Rv were collected from the Department of Microbiology at Vallabhbhai Patel Chest Institute, University of Delhi, Delhi, India. The clinical isolates were obtained as part of a convenience sample obtained from new smear positive patients of pulmonary tuberculosis attending the Department of Respiratory Medicine at Vallabhbhai Patel Chest Institute which serves as a referral center for patients with respiratory diseases in North India. Cultures were grown on Lowenstein Jensen (LJ) medium slants and in Middlebrook 7H9 broth (Difco Laboratories, Detroit, MI) supplemented with OADC (oleic acid, albumin bovine, fraction V, dextrose, catalase) (Difco) and 0.2% glycerol at 37°C.
All the isolates (n = 130) were characterized by niacin, nitrate and catalase tests [14] and confirmed as M. tuberculosis complex (MTBC) by PCR Restriction Analysis (PRA) [15].
Drug susceptibility profile
Indirect drug susceptibility testing to RIF was performed by the proportion method of drug susceptibility testing (PDST) for all the isolates, as described by the Revised National Tuberculosis Control Programme (RNTCP) of India [16]. The critical concentration of RIF used was 40μg/ml.
DNA sequencing
The molecular drug resistance was confirmed by Sanger DNA sequencing performed by M/s Ist Base Asia, Malaysia for a subset of the isolates (41/130). DNA for sequencing was obtained from the same culture that was used for phenotypic RIF susceptibility testing.
Selection of isolates for study of efflux pumps
On the basis of drug susceptibility test results and mutation studies, 27 clinical isolates (16 RIF resistant and 11 RIF sensitive) of M. tuberculosis were selected for further study.
The isolates were divided into two groups. Group I consisted of 5 RIF resistant and 5 RIF susceptible isolates that were screened for the activity of 10 efflux pumps in a preliminary study. Group II consisted of 11 RIF resistant and 6 RIF susceptible isolates tested for the activity of four efflux pumps (Table 1).
MIC determination
RIF, verapamil and Carbonyl Cyanide 3-Chlorophenylhydrazone (CCCP) were obtained from Sigma Aldrich (St. Louis, MO, USA). RIF and CCCP were dissolved in DMSO, and verapamil was dissolved in deionized water. 1000 mg/L stock solutions were freshly prepared for RIF as well as efflux pump inhibitors and filter sterilized (using 0.22μ filter) before use.
MIC to RIF was determined for the 27 M. tuberculosis isolates selected for study of efflux pumps. Verapamil and CCCP were tested for 12 clinical isolates (Table 2). MIC was determined by Microplate Alamar Blue Assay (MABA) and performed in 96-well U-bottom plates as described previously with minor modifications [17]. Growth controls (medium containing inoculum but no antibiotic) and sterility controls (medium without inoculum and antibiotic) were also included in the assay. Each concentration of drug and inhibitors was tested in triplicates and the procedure was repeated a minimum of three times. All the isolates for the present study were carefully selected and were the ones showing no variation in MICs of drug/inhibitor on repeated testing. The strains were considered as low level resistant (LLR) for RIF if their MIC ranged between 1–16 mg/L and high-level resistant (HLR) for RIF if the MIC was ≥ 32 mg/L [18].
MIC of RIF was also determined in the presence of efflux pump inhibitors verapamil and CCCP. MICs of RIF for all the isolates, in the presence of subinhibitory concentrations (1/2 MIC) of verapamil and CCCP, were determined as described previously [19]. The MICs were tested in triplicates atleast thrice to get a minimum of three consistent values.
In vitro drug exposure to M. tuberculosis clinical strains and H37Rv
M. tuberculosis H37Rv and the clinical isolates were cultured in flasks containing Middlebrook 7H9 medium supplemented with 0.2% glycerol and 0.05% tween 80. The freshly growing culture of each isolate (10 ml) at mid log phase (OD600 ~0.5) was exposed to subinhibitory concentration of RIF (1/4 MIC) [20] (Table 1) and incubated at 37°C for 24 hours as described previously [21]. Unexposed culture was taken as control. Cell pellets were collected by centrifugation (8,000 rpm, 10 minutes, RT), washed once with 10 ml drug free medium, resuspended in 10 ml RNA protection buffer (Qualigens) and stored at -80°C as 1ml aliquots for RNA isolation.
RNA Isolation and cDNA Preparation
RNA was isolated from exposed and unexposed cultures by using the RNeasy mini kit (Qiagen GmbH, Hilden, Germany), according to the manufacturer's instructions followed by DNase I (Thermo Fischer Scientific Inc., Waltham, MA) treatment as described previously [20]. The quality and quantity of the isolated RNA was determined by virtual gel electrophoresis on the DNR Bio-Imaging Systems (MiniLumi) and by spectrophotometric measurement (Tecan Infinite F200 Pro) of the A260/A280 ratio. The cDNA was synthesized using random hexamer primers provided with the First strand cDNA synthesis kit (Fermentas Life Sciences, Lithuania) according to the manufacturer’s instructions.
Selection of efflux pump genes
Ten putative efflux genes (Rv1273c, Rv1458c, Rv0194, Rv1819c, Rv1634, Rv1250, Rv1877, mmpL5, Rv3823c, mmpL2) predicted as membrane transporters of M. tuberculosis H37Rv and selected on the basis of presence of high confidence mutations (HCM) in a multidrug resistant clinical isolate of M. tuberculosis, were included in the study [20]. The HCM were predicted after comparative analysis with the gene sequence of a MDR strain of M. tuberculosis, available at Open Source Drug Discovery [22].
Generation of primers
Previously published primers were used for the efflux pump genes Rv1273c, Rv1458c, Rv0194, Rv1819c, Rv1634, Rv1250, Rv1877, mmpL5, Rv3823c, mMmpL2 and for the internal control sigA [20]. Sequences of rpoB and the house keeping gene rrs were retrieved from http://genolist.pasteur.fr/Tuberculist/ [23] and the primers were designed using Gene Runner Version 3.01 software. The desired sequences were synthesized by Sigma Aldrich (INDIA). The primer sequences designed were as follows:
rpoB F 5’ AGACGTTGATCAACATCCG 3’
R 5’ ACCTCCAGCCCGGCACGCTCACGT 3’
rrs F 5’ CGTCAGCTCGTGTCGTGAGATG 3’
R 5’ GCATCGCAGCCCTTTGTACC 3’
Real time expression analysis
Quantitative real time PCR (qRT-PCR) was performed to study the expression of putative drug efflux genes by using Quantitect SYBR Green Master mix kit (Roche Applied Science, Indianapolis, USA) in a Light Cycler 480 II real time PCR system (Roche Applied Science, Indianapolis, USA). The housekeeping sigma factor gene sigA and 16S rRNA gene rrs were used as internal controls in qRT-PCR assays [20, 24, 25]. Melt curve analysis was performed after each run in a LightCycler 480II instrument to confirm the specificity of the primers. Each qRT-PCR experiment was done on duplicate biological samples which were further assayed in triplicates. The starting amounts of cDNA for the amplification of putative efflux genes and the reference genes were equalized for each sample at 1.5 ng/μl. Relative quantification in clinical isolates was done to determine overexpression of efflux genes in cultures exposed to drug stress as compared to unexposed cultures, by 2-ΔΔCt method [26]. The data was analyzed using the built in quantification software. A relative expression equal to one indicated that the expression level was identical to the control, a fold change ≥2.5 was considered as significant overexpression.
Data analysis
GraphPad Software (GraphPad Software Inc., La Jolla, CA, USA) was used to perform the Fisher’s Exact test. The difference in the number of susceptible and resistant isolates overexpressing efflux pumps was considered to be statistically significant if p <0.05.
Results
PDST and rpoB mutations
Of the 130 isolates of M. tuberculosis tested by PDST, 33 were found to be RIF resistant and 97 were RIF susceptible. Of these, presence or absence of mutations in the rpoB RRDR was confirmed by sequencing in 30 RIF resistant and 11 RIF susceptible isolates. Among the RIF resistant isolates, three did not contain any mutations in the rpoB RRDR while the remaining 27 isolates were found to have RRDR mutations.
The most common RRDR mutation was at codon 531 (22/27; 81.5%). This was followed by mutations at codon 526 (2/27; 7.4%) and one each at codons 511, 516, 518 (1/27; 3.7%). No mutations were observed in the RIF susceptible isolates.
Spectrum of mutations in the rpoB gene of isolates selected for efflux pump study
To understand the significance of efflux pumps in RIF resistance, a subset of the resistant isolates having mutations at the RRDR of rpoB gene (n = 13), all the resistant isolates with no mutations at the RRDR of rpoB gene (n = 3) and all the sequenced susceptible isolates (n = 11) were included in the study group.
Among the 13 RIF resistant isolates with mutations, the mutation C>T at codon 531 was the most common, seen in 12/13 (92.3%) isolates. A single isolate, EP2-R4-15 had a mutation T>C at codon 511 (Table 1). No mutations in the RRDR of rpoB gene were observed in any of the RIF susceptible isolates.
MICs of RIF and efflux pump inhibitors in the M. tuberculosis clinical isolates
MICs of RIF in the 16 RIF resistant isolates tested were ≥2 mg/L. Of these, 8/16 (50%) were low level resistant (LLR) with MIC ranging from 2–16 mg/L. The remaining (8/16; 50%) were high level resistant (HLR) with MIC ≥ 32 mg/L. MIC of 10 RIF susceptible isolates was ≤1 mg/L and one RIF susceptible isolate had MIC 2 mg/L (Table 1).
The MICs of efflux pump inhibitors were determined in a subset of isolates (6 RIF resistant and 6 RIF susceptible). The MICs of verapamil ranged from 40–120 mg/L and that of CCCP from 0.04–0.13 mg/L (Table 2).
Correlation of mutations and MIC
On correlating the mutations at rpoB gene with MICs, we observed that most of the isolates with mutation C>T at codon 531 (8/12) had high level resistance to RIF (MIC ≥ 32 mg/L). The single isolate with mutation T>C at codon 511 had low level resistance to RIF (MIC = 2 mg/L). The resistant isolates with no mutations (n = 3) had MICs ranging from 2–4 mg/L (Table 1).
Real time analysis of efflux pump genes
In a preliminary investigation, the real time expression of efflux genes Rv1273c, Rv1458c, Rv0194, Rv1819c, Rv1634, Rv1250, Rv1877, mmpL5, Rv3823c, mmpL2 was studied in Group I isolates consisting of five RIF resistant and five RIF susceptible M. tuberculosis isolates using sigA as the internal control. Of the five RIF resistant isolates, three showed increased expression of Rv1250 and Rv0194. mmpL2 and mmpL5 were upregulated in two and one RIF resistant isolates respectively. None of the five RIF susceptible isolates showed significant increase in the expression of efflux genes Rv0194, Rv1250, mmpL2 or mmpL5 (Fig 1). The remaining genes were either expressed in more number of susceptible isolates (Rv1273, Rv1458c and Rv1877) or not expressed at all (Rv1819c, Rv3823c), except Rv1634 which was overexpressed in greater number of resistant isolates though the difference was not statistically significant (p>0.05). Further, 11 RIF resistant and 6 RIF susceptible isolates were included in the study (Group II). The real time expression of the efflux genes showing upregulation in RIF resistant isolates in Group I viz. mmpL5, mmpL2, Rv1250 and Rv0194, was studied in the additional isolates using sigA and rrs as the internal control genes. A gene was considered to be upregulated only if it showed increased expression when normalized with both the internal control genes individually. mmpL5 was upregulated in 6/11 (54.5%) RIF resistant isolates as compared to 1/6 (16.6%) RIF susceptible isolates in Group II (p = 0.16) (Fig 2A); Rv0194 was upregulated in 5/11 (45.4%) RIF resistant isolates as compared to 2/6 (33.3%) RIF susceptible isolates (p = 0.50). One of the susceptible isolates with significant upregulation of Rv0194 had MIC 2 mg/L (Fig 2D). Rv1250 showed increased expression in 1/11 (9%) RIF resistant and 2/6 (33%) RIF susceptible (MIC 0.125 mg/L and 2 mg/L) clinical isolates (p = 0.59) (Fig 2C). Rv1250 was also upregulated in H37Rv. mmpL2 was upregulated only in one susceptible clinical isolate and in none of the RIF resistant isolates (Fig 2B). Amongst the RIF susceptible isolates, one isolate, EP2-S4-15, showed upregulation of all the four genes mmpL5, mmpL2, Rv1250 and Rv0194 (Table 1).
The drug concentrations used for exposure were 1/4 MIC of RIF. sigA was used as an internal control. The experiment was performed in triplicates with two biological replicates. X-axis denotes the isolates used in the study. A line was drawn on X-axis between sensitive and resistant isolates. Y-axis denotes the fold increase in expression. Fold expression equal to 1 corresponds to no alterations in expression as compared with unexposed control. Fold change ≥2.5 in gene expression, relative to the non-exposed control denotes significant overexpression.
The drug concentrations used for exposure were 1/4 MIC of RIF. Two internal control genes used were sigA and rrs. The experiment was performed in triplicates with two biological replicates. X-axis denotes the isolates used in the study. Y-axis denotes the fold change in expression. Fold expression equal to 1 corresponds to no alterations in expression as compared with unexposed control. Fold change ≥2.5 in gene expression, relative to the non-exposed control denotes significant overexpression.
Correlation between MIC, rpoB mutations and efflux pump gene upregulation
Amongst the Group I isolates, one was HLR to RIF and had a mutation (C>T) at codon 531 (EP1-R1-13). This strain also upregulated mmpL5. Group II had 7 isolates HLR to RIF. All these isolates had the mutation C>T at codon 531 of the rpoB. Of these, 5 showed upregulation of one or more efflux pump genes. Efflux pump genes mmpL5 and Rv0194 were each overexpressed in 3/5 HLR isolates.
Of the 4 isolates with LLR to RIF in Group I, only one isolate had a mutation C>T at codon 531, while all 4 showed upregulation of one or more efflux pumps. Amongst the Group II isolates with LLR (n = 4), one isolate had a mutation T>C at codon 511 (Table 1) and also overexpressed mmpL5, Rv0194 and Rv1250. Mutation C>T at codon 531 was observed in 3 of the LLR isolates in Group II. mmpL5 was upregulated in two of these isolates and Rv0194 was upregulated in one isolate. The third isolate with a mutation C>T at codon 531 and LLR did not overexpress any efflux pump gene. One isolate (EP2-S6-15) was phenotypically susceptible to RIF. However, its MIC showed the isolate to be LLR to RIF. Though, the isolate did not have any mutations in the RRDR, it showed upregulation of Rv0194 and Rv1250.
Effect of efflux pump inhibitors on the MICs of RIF in the M. tuberculosis clinical isolates
To further examine the role of efflux pumps in RIF resistance, the changes in the level of resistance to RIF in the presence of efflux pump inhibitors verapamil and CCCP were studied in a subset of isolates (6 RIF susceptible and 6 RIF resistant) (Table 2). In all the RIF resistant isolates (n = 6), a minimum 4 fold decrease was observed in the MIC of RIF in the presence of verapamil. In the presence of CCCP, decrease in MIC was at least 2 fold in 4/6 RIF resistant isolates. Of the 6 susceptible isolates, 5 isolates showed >4 fold decrease in the MICs of RIF in the presence of verapamil. Addition of CCCP also led to at least 4 fold decrease in RIF MICs in 4/6 RIF susceptible isolates (Table 2).
Discussion
The standard treatment for TB is a multidrug regimen that includes RIF and INH, two of the most efficacious drugs against M. tuberculosis infection. The development of resistance to these two drugs reduces the efficacy of standard anti-TB treatment by up to 77% [27]. The MDR phenotype is caused by sequential accumulation of mutations in different genes involved, due to inappropriate treatment or poor adherence to treatment [7, 28]. On the other hand, continued exposure of the organism to the drugs might lead to the activation of other mechanisms like efflux pumps which in turn help them resist the stress. In the present work, our focus was to study the efflux pumps related to RIF resistance in M. tuberculosis. The present investigation attempted to study efflux pumps as an additional mechanism leading to RIF resistance.
We first subjected a subset of isolates in the study to sequencing of the 81bp RRDR. Of the 16 RIF resistant isolates selected for the study (comprising of 5 RIF resistant isolates in group I and 11 in group II), 8 isolates showed high level resistance to RIF. All these isolates had mutation C>T at codon 531. The amino acid alterations at codon 531 have been seen to cause high level resistance to RIF by previous investigators also [2, 29].
It has also been observed, that mutations at codons 511, 516 and 522 cause low level resistance to RIF [18, 30]. The low level RIF resistant isolates in our study showed a varied spectrum of mutations. While one LLR isolate had a mutation at codon 511, three other isolates had no mutations. Surprisingly, unlike the observations of previous investigators [2, 29], 4 LLR isolates had mutations at codon 531.
To unravel the mechanisms of drug resistance in M. tuberculosis, many studies have elucidated the role of efflux pump genes using mRNA expression and DNA microarray analysis [31, 32, 33, 34]. In the present study, we analyzed the expression of efflux pump genes by qRT-PCR, in RIF resistant and RIF susceptible M. tuberculosis isolates after exposure to subinhibitory concentrations of RIF. Calgin et al have shown an increase in the expression of several efflux pump genes in the clinical strains which could be due to the exposure of anti-TB drugs during treatment of patients causing constitutive expression of efflux systems leading to increased MIC levels of the anti-TB drugs [35].
The efflux genes Rv1273c, Rv1458c, Rv0194, Rv1819c, Rv1634, Rv1250, Rv1877, mmpL5, Rv3823c, mmpL2 were analysed in 5 RIF resistant and 5 RIF susceptible isolates, in a preliminary experiment (Group 1 isolates). Of the RIF resistant isolates, two isolates had a C>T mutation at codon 531 of rpoB gene. Surprisingly, three of the isolates, though resistant by PDST, did not have any mutations in the rpoB region. However, the MIC of these isolates was 2–4 mg/L. Several other investigators have also reported RIF resistant isolates without any mutations in the RRDR [36, 37, 38, 39, 40]. We observed that the efflux genes mmpL5, mmpL2, Rv1250 and Rv0194 were upregulated only in the RIF resistant clinical isolates in this initial study. This prompted us to increase the number of isolates studied. Hence, we added a set of 11 RIF resistant and 6 RIF susceptible isolates to the study and analyzed these for upregulation of mmpL5, mmpL2, Rv1250 and Rv0194 as well as rpoB mutations in the RRDR.
We also tested a subset of isolates (6 RIF resistant and 6 RIF susceptible) in Group II, for the effect of efflux pump inhibitors on the MICs of RIF. The efflux pump inhibitor verapamil led to reduction in RIF MICs of all the resistant and 5/6 of the susceptible isolates. Caleffi-Ferracioli et al have also shown that verapamil combined with rifampicin lead to downregulation of efflux pump related genes [41]. In addition, it has been shown previously, that verapamil can partially restore susceptibility to RIF in RIF resistant isolates [42]. It has also been demonstrated that the addition of verapamil to standard anti-TB chemotherapy increased the clearance of MDR M. tuberculosis strains in mice, thus highlighting the involvement of efflux pumps in drug resistance in M. tuberculosis [43]. CCCP also reduced RIF MICs in 4/6 RIF resistant and 4/6 RIF susceptible isolates. The reduction in MIC of RIF in susceptible isolates, evidenced a basal level of activity of efflux pumps in the M. tuberculosis isolates. Louw et al, [21] and Li et al, [34] also observed a reduction in MIC of RIF in RIF resistant isolates, with CCCP and reserpine.
Amongst the additional set of 11 RIF resistant M. tuberculosis isolates (Group II), all had a mutation in the rpoB gene. However, 8 of these also had one or more efflux pump genes overexpressed. It is possible that the remaining isolates with mutations had alternative efflux pumps active which were not analyzed in the present study. It is interesting to note that one isolate, EP2-S6-15, in group II was repeatedly found to be susceptible by PDST. It did not have any mutation in the rpoB gene, however, the region outside the RRDR was not sequenced in the present study. This isolate had MIC 2 mg/L and also showed upregulation of efflux genes Rv0194 and Rv1250. The development of drug resistance is a sequential process. Efflux pumps maintain a low level of drug inside the bacterium, thus exposing the organism to a sublethal dose of the drug that induces the organism to develop resistance [44]. It is possible that the isolate EP2-S6-15, developed a low level resistance due to the presence of efflux pumps. It would be interesting to follow up such isolates to see if the propensity of the isolate to develop LLR, would also make it prone to develop mutations in the RRDR on exposure to anti-TB agents.
On studying the efflux pumps in these isolates and using 2 internal control genes to increase the stringency of our results, we observed that mmpL2 was upregulated only in one susceptible isolate and in none of the RIF resistant isolates. Thus, its role in RIF resistance could not be established. Rv1250 was upregulated in one RIF resistant and two RIF susceptible isolates. Rv1250 had been shown to increase its expression in MDR-TB isolates under RIF stress in an earlier study [34]. However, in our study, in addition to one RIF resistant isolate two susceptible isolates also upregulated the gene. It was interesting to note, that Li et al [34] had used a single internal control in their qRT-PCR experiments, whereas we had increased the stringency of our assay by using two internal controls.
mmpL5 was upregulated in 6 RIF resistant and one RIF susceptible isolate. We also observed that the RIF resistant isolates in which mmpL5 was upregulated had a mutation in the rpoB gene, though the RIF resistant isolates showing overexpression of the gene were greater in number. Rv0194 was upregulated in 5 RIF resistant and 2 RIF susceptible isolates. It is notable that, in our study Rv0194 was also expressed in three WT RIF resistant isolates. In a previous study, overexpression of Rv0194 had been shown to increase the MICs of ampicillin, vancomycin, novobiocin, and erythromycin for M. smegmatis [45]. The difference between the resistant and susceptible isolates in the expression of Rv0194 and mmpL5 in Group II was not statistically significant. Though, this is a preliminary study, limited to a small number of clinical isolates, overexpression of efflux pumps Rv0194 and mmpL5 in a greater number of RIF resistant isolates as compared to RIF susceptible isolates suggests a role in RIF resistance.
Conclusion
Our study reiterated the importance of chromosomal mutations in RIF resistance. The study suggests that basal level RIF resistance imparted by the efflux pumps, more particularly, the role of MmpL5 and Rv0194 needs to be investigated further to gain additional insights into the mechanisms of efflux associated RIF resistance in clinical isolates of M. tuberculosis.
Zdroje
1. Mitchison DA, Nunn AJ. Influence of initial drug resistance on the response to short-course chemotherapy of pulmonary tuberculosis. Am. Rev. Respir. Dis. 1986; 133 : 423–430. doi: 10.1164/arrd.1986.133.3.423 2420242
2. Somoskovi A, Parsons LM, Salfinger M. The molecular basis of resistance to isoniazid, rifampin, and pyrazinamide in Mycobacterium tuberculosis. Respir Res. 2001;2(3):164–168. doi: 10.1186/rr54 11686881
3. Felmlee TA, Liu Q, Whelen AC, Williams D, Sommer SS, Persing DH. Genotypic detection of Mycobacterium tuberculosis rifampicin resistance: Comparison of single-strand conformation polymorphism and dideoxy fingerprinting. J. Clin Microbiol. 1995; 33 : 1617–1623. 7650198
4. Garcia de Viedma D, del Sol Diaz Infantes M, Lasala F, Chaves F, Alcala L, Bouza E. New realtime PCR able to detect in a single tube multiple rifampin resistance mutations and high-level isoniazid resistance mutations in Mycobacterium tuberculosis. J Clin Microbiol. 2002;40(3):988–995. doi: 10.1128/JCM.40.3.988-995.2002 11880428
5. Campbell EA, Korzheva N, Mustaev A, Murakami K, Nair S, Goldfarb A, et al. Structural mechanism for rifampicin inhibition of bacterial RNA polymerase. Cell. 2001;104 : 901–912. doi: 10.1016/s0092-8674(01)00286-0 11290327
6. Betts JC, Lukey PT, Robb LC, McAdam RA, Duncan K. Evaluation of a nutrient starvation model of Mycobacterium tuberculosis persistence by gene and protein expression profiling. Mol. Microbiol. 2002;43 : 717–731. doi: 10.1046/j.1365-2958.2002.02779.x 11929527
7. Ramaswamy S, Musser JM. Molecular genetic basis of antimicrobial agent resistance in Mycobacterium tuberculosis: 1998 update. Tuber Lung Dis. 1998;79(1):3–29. doi: 10.1054/tuld.1998.0002 10645439
8. Heym B, Cole ST. Multidrug resistance in Mycobacterium tuberculosis. Int J Antimicrob Agents. 1997;8(1):61–70. 18611785
9. Banerjee SK, Bhatt K, Misra P, Chakraborti PK. Involvement of a natural transport system in the process of efflux-mediated drug resistance in M. smegmatis. Mol Gen Genet. 2000;262(6):949–956. doi: 10.1007/pl00008663 10660056
10. Siddiqi N, Das R, Pathak N, Banerjee S, Ahmed N, Katoch VM et al. Mycobacterium tuberculosis isolate with a distinct genomic identity overexpresses a tap-like efflux pump. Infection. 2004;32(2):109–111. doi: 10.1007/s15010-004-3097-x 15057575
11. Gupta AK, Chauhan DS, Srivastava K, Das R, Batra S, Mittal M et al. Estimation of efflux mediated multi-drug resistance and its correlation with expression levels of two major efflux pumps in mycobacteria. J Commun Dis. 2006;38(3):246–254. 17373356
12. Jiang X, Zhang W, Zhang Y, Gao F, Lu C, Zhang X et al. Assessment of efflux pump gene expression in a clinical isolate Mycobacterium tuberculosis by real-time reverse transcription PCR. Microb Drug Resist. 2008;14 : 7–11. doi: 10.1089/mdr.2008.0772 18321205
13. Pang Y, Lu J, Wang Y, Song Y, Wang S, Zhao Y. Study of the rifampin monoresistance mechanism in Mycobacterium tuberculosis. Antimicrob Agents Chemother. 2013;57(2):893–900. doi: 10.1128/AAC.01024-12 23208715
14. Kent PT, Kubica GP. Public health mycobacteriology: A guide for the level III laboratory. Centers for Diseases Control, Atlanta. 1985.
15. Varma-Basil M, Garima K, Pathak R, Dwivedi SK, Narang A, Bhatnagar A et al. Development of a novel PCR restriction analysis of the hsp65 gene as a rapid method to screen for the Mycobacterium tuberculosis complex and nontuberculous mycobacteria in high-burden countries. J ClinMicrobiol. 2013;51(4):1165–1170.
16. Standard operating procedures for C&DST labs. Central TB Division [Internet]. [cited 10 January 2016]. Available from: https://tbcindia.gov.in
17. Franzblau SG, Witzig RS, McLaughlin JC, Torres P, Madico G, Hernandez A et al. Rapid, low-technology MIC determination with clinical Mycobacterium tuberculosis isolates by using the microplate Alamar Blue assay. J Clin Microbiol. 1998;36(2):362–366. 9466742
18. Huitric E, Werngren J, Juréen P, Hoffner S. Resistance levels and rpoB gene mutations among in vitro-selected rifampin-resistant Mycobacterium tuberculosis mutants. Antimicrob Agents Chemother. 2006;50(8):2860–2862. doi: 10.1128/AAC.00303-06 16870787
19. Gupta AK, Katoch VM, Chauhan DS, Sharma R, Singh M, Venkatesan K et al. Microarray analysis of efflux pump genes in multidrug-resistant Mycobacterium tuberculosis during stress induced by common anti-tuberculous drugs. Microb Drug Resist. 2010;16(1):21–28. doi: 10.1089/mdr.2009.0054 20001742
20. Garima K, Pathak R, Tandon R, Rathor N, Sinha R, Bose M et al. Differential expression of efflux pump genes of Mycobacterium tuberculosis in response to varied subinhibitory concentrations of antituberculosis agents. Tuberculosis (Edinb). 2015;95(2):155–161.
21. Louw GE, Warren RM, Gey van Pittius NC, Leon R, Jimenez A, Hernandez-Pando R, McEvoy CR et al. Rifampicin reduces susceptibility to ofloxacin in rifampicin-resistant Mycobacterium tuberculosis through efflux. Am J Respir Crit Care Med. 2011;184(2):269–276. doi: 10.1164/rccm.201011-1924OC 21512166
22. Osdd.net. Open Source Drug Discovery [Internet]. [cited 9 April 2013]. Available from: http://www.osdd.net.
23. Genolist.pasteur.fr. TubercuList Web Server [Internet]. 2008 [cited 9 March 2013]. Available from: http://genolist.pasteur.fr/TubercuList/.
24. Lam TH, Yuen KY, Ho PL, Wong KC, Leong WM, Law HK et al. Differential fadE28 expression associated with phenotypic virulence of Mycobacterium tuberculosis. Microb Pathog. 2008;45(1):12–17. doi: 10.1016/j.micpath.2008.01.006 18486437
25. Masiewicz P, Brzostek A, Wolański M, Dziadek J, Zakrzewska-Czerwińska J. A novel role of the PrpR as a transcription factor involved in the regulation of methylcitrate pathway in Mycobacterium tuberculosis. PLoS One. 2012;7(8):e43651. doi: 10.1371/journal.pone.0043651 22916289
26. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262 11846609
27. Heymann SJ, Brewer TF, Wilson ME, Fineberg HV. The need for global action against multidrug-resistant tuberculosis. JAMA 1999; 281 : 2138–2140. doi: 10.1001/jama.281.22.2138 10367825
28. Gillespie SH, Billington OJ, Breathnach A, McHugh TD. Multiple drug-resistant Mycobacterium tuberculosis: evidence for changing fitness following passage through human hosts. Microb Drug Resist. 2002;8(4):273–279. doi: 10.1089/10766290260469534 12523624
29. Ohno H, Koga H, Kohno S, Tashiro T, Hara K. Relationship between rifampin MICs for and rpoB mutations of Mycobacterium tuberculosis strains isolated in Japan. Antimicrob Agents Chemother. 1996;40(4):1053–1056. 8849230
30. Feuerriegel S, Oberhauser B, George AG, Dafae F, Richter E, Rüsch-Gerdes S et al. Sequence analysis for detection of first-line drug resistance in Mycobacterium tuberculosis strains from a high-incidence setting BMC Microbiol. 2012;12 : 90. doi: 10.1186/1471-2180-12-90 22646308
31. Wilson M, De Risi J, Kristensen HH, Imboden P, Rane S, Brown PO et al. Exploring drug-induced alterations in gene expression in Mycobacterium tuberculosis by microarray hybridization. ProcNatlAcadSci U S A. 1999;96(22):12833–12838.
32. Betts JC, McLaren A, Lennon MG, Kelly FM, Lukey PT, Blakemore SJ et al. Signature gene expression profiles discriminate between isoniazid-, thiolactomycin-, and triclosan-treated Mycobacterium tuberculosis. Antimicrob Agents Chemother. 2003;47(9):2903–2913. doi: 10.1128/AAC.47.9.2903-2913.2003 12936993
33. Fu LM, Tai SC. The Differential Gene Expression Pattern of Mycobacterium tuberculosis in Response to Capreomycin and PA-824 versus First-Line TB Drugs Reveals Stress - and PE/PPE-Related Drug Targets. Int J Microbiol. 2009;2009 : 879621. doi: 10.1155/2009/879621 20016672
34. Li G, Zhang J, Guo Q, Jiang Y, Wei J, Zhao LL et al. Efflux pump gene expression in multidrug-resistant Mycobacterium tuberculosis clinical isolates. PLoS One. 2015;10(2):e0119013. doi: 10.1371/journal.pone.0119013 25695504
35. Calgin MK, Sahin F, Turegun B, Gerceker D, Atasever M, Koksal et al. Expression analysis of efflux pump genes among drug-susceptible and multidrug-resistant Mycobacterium tuberculosis clinical isolates and reference strains. Diagn Microbiol Infect Dis. 2013;76(3):291–7. doi: 10.1016/j.diagmicrobio.2013.02.033 23561272
36. Ahmad S, Mokaddas E, Fares E. Characterization of rpoB mutations in rifampin-resistant clinical Mycobacterium tuberculosis isolates from Kuwait and Dubai. Diagn Microbiol Infect Dis. 2002;44(3):245–252. doi: 10.1016/s0732-8893(02)00457-1 12493171
37. Deepa P, Therese KL, Madhavan HN. Detection and Characterization of mutations in rifampicin resistant Mycobacterium tuberculosis clinical isolates by DNA sequencing. Indian J Tuberc 2005;52 : 132–136.
38. McCammon MT, Gillette JS, Thomas DP, Ramaswamy SV, Graviss EA, Kreiswirth BN et al. Detection of rpoB mutations associated with rifampin resistance in Mycobacterium tuberculosis using denaturing gradient gel electrophoresis. Antimicrob Agents Chemother. 2005;49(6):2200–2209. doi: 10.1128/AAC.49.6.2200-2209.2005 15917513
39. Ahmad S, Al-Mutairi NM, Mokaddas E. Variations in the occurrence of specific rpoB mutations in rifampicin-resistant Mycobacterium tuberculosis isolates from patients of different ethnic groups in Kuwait. Indian J Med Res. 2012;135(5):756–762. 22771609
40. Qazi O, Rahman H, Tahir Z, Qasim M, Khan S, Ahmad Anjum A et al. Mutation pattern in rifampicin resistance determining region of rpoB gene in multidrug-resistant Mycobacterium tuberculosis isolates from Pakistan. Int J Mycobacteriol. 2014;3(3):173–177. doi: 10.1016/j.ijmyco.2014.06.004 26786485
41. Caleffi-Ferracioli KR, Amaral RC, Demitto FO, Maltempe FG, Canezin PH, Scodro RB et al. Morphological changes and differentially expressed efflux pump genes in Mycobacterium tuberculosis exposed to a rifampicin and verapamil combination. Tuberculosis (Edinb). 2016;97 : 65–72.
42. Pule CM, Sampson SL, Warren RM, Black PA, van Helden PD, Victor TC et al. Efflux pump inhibitors: targeting mycobacterial efflux systems to enhance TB therapy. J Antimicrob Chemother. 2016;71(1):17–26. doi: 10.1093/jac/dkv316 26472768
43. Gupta S, Tyagi S, Almeida DV, Maiga MC, Ammerman NC, Bishai WR. Acceleration of tuberculosis treatment by adjunctive therapy with verapamil as an efflux inhibitor. Am J Respir Crit Care Med. 2013;188(5):600–7. doi: 10.1164/rccm.201304-0650OC 23805786
44. Machado D, Couto I, Perdigão J, Rodrigues L, Portugal I, Baptista P et al. Contribution of efflux to the emergence of isoniazid and multidrug resistance in Mycobacterium tuberculosis. PLoS One. 2012;7(4):e34538. doi: 10.1371/journal.pone.0034538 22493700
45. Danilchanka O, Mailaender C, Niederweis M. Identification of a novel multidrug efflux pump of Mycobacterium tuberculosis. Antimicrob Agents Chemother. 2008;52(7):2503–2511. doi: 10.1128/AAC.00298-08 18458127
Článok vyšiel v časopise
PLOS One
2019 Číslo 9
- Metamizol jako analgetikum první volby: kdy, pro koho, jak a proč?
- Masturbační chování žen v ČR − dotazníková studie
- Časná postcovidová péče u pacientů starších 65 let
- Očima epidemiologů: Rok s pandemií a co bychom si z něj měli odnést do budoucna?
- Duševní poruchy u klíšťové encefalitidy
Najčítanejšie v tomto čísle
- Graviola (Annona muricata) attenuates behavioural alterations and testicular oxidative stress induced by streptozotocin in diabetic rats
- CH(II), a cerebroprotein hydrolysate, exhibits potential neuro-protective effect on Alzheimer’s disease
- Comparison between Aptima Assays (Hologic) and the Allplex STI Essential Assay (Seegene) for the diagnosis of Sexually transmitted infections
- Assessment of glucose-6-phosphate dehydrogenase activity using CareStart G6PD rapid diagnostic test and associated genetic variants in Plasmodium vivax malaria endemic setting in Mauritania