-
Články
- Časopisy
- Kurzy
- Témy
- Kongresy
- Videa
- Podcasty
Molecular evolution of genes encoding allergen proteins in the peanuts genus Arachis: Structural and functional implications
Authors: Khidir W. Hilu aff001; Sheena A. Friend aff001; Viruthika Vallanadu aff001; Anne M. Brown aff002; Louis R. Hollingsworth, IV aff003; David R. Bevan aff003
Authors place of work: Department of Biological Sciences, Virginia Tech, Blacksburg, VA, United States of America aff001; Research and Informatics, Virginia Tech, Blacksburg, VA, United States of America aff002; Department of Biochemistry, Virginia Tech, Blacksburg, VA, United States of America aff003
Published in the journal: PLoS ONE 14(11)
Category: Research Article
doi: https://doi.org/10.1371/journal.pone.0222440Summary
Food allergies are severe immune responses to plant and animal products mediated by immunoglobulin E (IgE). Peanuts (Arachis hypogaea L.) are among the top 15 crops that feed the world. However, peanuts is among the “big eight food allergens”, and allergies induced by peanuts are a significant public health problem and a life-threatening concern. Targeted mutation studies in peanuts demonstrate that single residue alterations in these allergen proteins could result in substantial reduction in allergenicity. Knowledge of peanut allergen proteins is confined to the allotetraploid crop and its two progenitors. We explored frequencies and positions of natural mutations in the hyperallergenic homologues Ara h 2 and Ara h 6 in newly generated sequences for 24 Arachis wild species and the crop species, assessed potential mutational impact on allergenicity using immunoblots and structural modeling, and evaluated whether these mutations follow evolutionary trends. We uncovered a wealth of natural mutations, both substitutions and gaps, including the elimination of immunodominant epitopes in some species. These molecular alterations appear to be associated with substantial reductions in allergenicity. The study demonstrated that Ara h 2 and Ara h 6 follow contrasting modes of natural selection and opposing mutational patterns, particularly in epitope regions. Phylogenetic analysis revealed a progressive trend towards immunodominant epitope evolution in Ara h 2. The findings provide valuable insight into the interactions among mutations, protein structure and immune system response, thus presenting a valuable platform for future manipulation of allergens to minimize, treat or eliminate allergenicity. The study strongly encourages exploration of genepools of economically important plants in allergenicity research.
Keywords:
Sequence alignment – Sequence motif analysis – Substitution mutation – Protein structure – Peanut – Allergens – Protein structure prediction – Evolutionary immunology
Introduction
Peanuts (Arachis hypogaea L.) are an important global commodity, being among the top 15 crops that feed the world and second only to soybean in terms of legume crop global production (FAOSTAT, www.fao.org/faostat). However, peanuts are one of the most common causes of severe food allergies being one of the “big eight food allergens, with worldwide prevalence of 0.5–2%, and are on the rise [1–3]. Allergies induced by peanuts are a significant public health problem and a life-threatening concern. The number of reported cases of children with food allergies rose by an alarming 18% from 1997 to 2007 [4], with allergies persisting beyond childhood [5], further accentuating the allergenicity problem. The symptoms of peanut allergy range from mild oral allergy syndrome to anaphylactic reactions to death [6, 7]. At present, there is no cure for peanut allergies. Immunotherapy has been used for gradual increase in tolerance to peanut allergenicity [8], but elevated sensitivity to treatment dosages at extremely small quantities could be hazardous. This has resulted in an agro-economic setback since peanuts seeds are valuable source of protein and oils, and used commercially in various industries [9, 10].
Food allergies are severe immune responses mediated by immunoglobulin E (IgE) to specific foods [1]. Over 50% of plant allergens, including peanuts allergens, belong to four structural protein families: prolamin superfamily, cupin superfamily, profilins, and Bet v-1-related proteins [7, 11–13]. The peanut species Arachis hypogaea is reported to contain 17 allergens (Ara h 1–17), with Ara h 4 being recently renamed Ara h 3.02, a total number of 16 allergens in peanut seeds are recognized (Allergen Nomenclature Sub-Committee of the World Health Organization/International Union of Immunological Societies, WHO/IUIS). Ara h 2 and Ara h 6 (prolamin superfamily, 2S albumin family) and Ara h 1 and Ara h 3 (cupin superfamily) are regarded as the major allergens in peanuts [14, 15], being recognized by >50% of allergenic people. Ara h 2 is considered to be the most potent allergen protein [14, 16, 17] since it is recognized by serum IgE of over 90% of the peanut-sensitive patients [16]. Ara h 6 shares similar immunological features with Ara h 2 [9, 18, 19], rendering these two proteins as the most powerful of all peanut allergens. Zhuang and Dreskin (2013) [20] noted that removing Ara h 2 and Ara h 6 allergen proteins together significantly reduced the effector activity of the peanut seeds crude protein extract, underscoring the reasons for our choice of these two homologues in this study. Further, Kulis et al. (2012)[21] and Bernard et al. (2015)[17] have emphasized the attractiveness of these homologues in therapeutic applications.
In addition to Ara h 2 and Ara h 6, the 2S albumin family is represented by Ara h 7, a less well-known allergen immunologically, with three isoforms reported in the literature [22–24]. Kelber-Janke et al.[23] detected sensitization to the Ara h 7.0101 isoform in 43% of peanut-sensitive subjects compared to 85% for Ara h 2. In an immunoassay study focusing on peanuts allergen reactions in three groups of patients, Cordreanu et al.[25] showed that only 43% of patients were sensitive to Ara h 7.0101 compared with 96% and 92% were sensitive to Ara h 2 and Ara h 6, respectively. Therefore, although Ara h 7 is an albumin-based allergen, it is not a major allergen compared with Ara h 2 and Ara h 6.
The peanut crop, A. hypogaea, is an allotetraploid comprising two genomes, AABB, with the A genome being contributed by A. duranensis and the B genome by A. ipaensis [26–28]. Our knowledge of allergenicity [29] in peanuts has been limited to the resolution of the primary and tertiary structures in the allotetraploid peanut crop species A. hypogaea and the two putative diploid progenitors [14, 28, 30]. Although the current knowledge represents a valuable foundation, it is limited and constrained by the strong sequence similarities among the allergen proteins of these three highly related species.
Herein, we examine Ara h 2 and Ara h 6 proteins of representative species from across the genus Arachis and seek to provide an in-depth understanding of the potential impact on structure and allergenicity of point mutations and loss/gain of sequence motifs, particularly those in the immunodominant epitopes. A number of studies have demonstrated that a single residue mutational event could significantly impact allergenicity in peanut species [14, 30–32]. For example, in Ara h 2, a targeted single amino acid mutation can result in a non-IgE binding epitope [14], and polymorphism in immunodominant epitope 7 in A. duranensis population resulted in 59–99% reduction in IgE binding activity [30]. Similarly, an increase in number of immunodominant epitopes is correlated with higher degrees of allergenicity[17]. Using newly generated nucleotide sequences of Ara h 2 and Ara h 6 from 24 of the approximately 80 Arachis wild species from clades spanning the entire tree, we determined naturally-occurring single nucleotide polymorphism (SNPs) and loss/gain of sequence motifs in the open reading frames (ORF) and their subsequent impact on amino acid composition. We placed these mutational events within a phylogenetic platform using the a phylogenetic tree of Friend et al. (2010)[33] to evaluate their modes of evolution, and determined potential selection pressure operating on them. To test the impact of mutational events on immunological reactivity, we conducted immunoblot experiments using Ara h 2 antigens from selected Arachis wild species. Further, we identified epitopes, generated tertiary structures for species with prominent mutations using homology modeling, and mapped relevant epitopes to the protein structures via sequence alignments. In total, this work provides new allergen protein sequence data for Arachis species and begins to connect this sequence information to protein structure and subsequently to allergenicity within a predicted evolutionary framework.
Materials and methods
Genomic DNA extraction, gene amplification and sequencing
Genomic DNA was isolated from fresh leaf material of 24 Arachis species (S1 Table) following Milla et al. (2005)[34]. Those species represent all the phylogenetic lineages of the genus depicted in Friend et al. (2010, summarized in Fig 1)[33]. Ara h 2 was amplified from 24 species and Ara h 6 from 23 species (Ara h 6 amplification failed in A. tubersosa) using the polymerase chain reaction (PCR) method with primers designed based on a sequence from A. hypogaea (GenBank accession AY007229). The Ara h 2 open reading frame (ORF) was amplified with primers ARAH2STARt (5’ ATGGCCAAGCTCACCATA 3’) and ARAH2-526 (5’ AGCTTGCCTTAGTTAACACG 3’), whereas the Ara h 6 ORF was amplified with primers ARAH6F (5’ ATGGCCAAGTCCACCATC 3’) and ARAH6R 556 (5’ CTATCACCACATTCATACAG 3’). Amplifications were conducted with 1x ThermoPol Buffer (New England Biolabs, Ipswich, MA), 200 μM dNTPs, 20 pmol of each primer, and 1.5 U Taq DNA polymerase (New England Biolabs, Ipswich, MA) in 25 μl reactions. PCR amplifications were carried out in a PTC-100 thermocycler (MJ Research, Waltham, MA) with 2 minutes of initial denaturing at 94°C, 25 cycles of 2 minutes denaturing at 94°C, 1 minute of primer annealing at 54°C, and 90 seconds extension at 72°C, followed by a final extension of 5 minutes at 72°C. Preparations of the PCR sequence reaction mixtures for Ara h 6 amplification followed the same protocol as in Ara h 2. The PCR conditions were 2 minutes of initial denaturing at 94°C, 39 cycles of 2 minutes denaturing at 94°C, 1 minute of primer annealing at 51°C, 90 seconds extension at 72°C, and a final extension of 15 minutes at 72°C. PCR product cleaning and sequencing followed Voshell et al. (2011)[35].
Fig. 1. Labeled triangles represent monophyletic groups with species examined in this study noted. Lineages received 1.0 posterior probability support except for Group Arachis II that received 0.97 support. Arachis hypogaea is represented by two cloned alleles corresponding to its respective progenitors A. duranensis and A. ipaensis. Sequence alignment
Nucleotide sequences in the phenograms were examined and manually edited in 4Peaks. Multiple alignments for Ara h 2 and Ara h 6 were generated initially using MUSCLE software [36] on CIPRES Science Gateway portal V. 3.3 (https://www.phylo.org/). The Ara h 6 alignment did not require manual editing whereas the Ara h 6 alignment was manually edited for accuracy in QuickAlign v. 1.03 [37] due to the presence of a large number gaps and and introduced frame shifts. Indels (insertions/deletions) were introduced in the alignment at a minimal cost of two substitutions [38] with special attention being paid to maintaining ORF integrity. The nucleotide alignments were translated into amino acids in MacClade Version 4.08a [39].
Amino acid and side chain composition
MEGA 6 [40] was used to determine the nucleotide composition of the Ara h 2 and Ara h 6 data sets. Excluded from both nucleotide and amino acid sequence composition analyses were A. helodes, A. trinitenses, and A. monticola to avoid data skewing since these nucleotide sequences start at position 103 compared with the other Arachis species. To avoid data duplication, we also excluded the allotetraploid A. hypogaea because its genomic composition is represented by the progenitors A. ipaensis and A. duranensis. To generate completely overlapping data sets of 19 species, we excluded A. tuberosa in Ara h 2 due to lack of an Ara h 6 sequence.
The frequencies and percentages of amino acids were computed for the two alleles across the 19 Arachis species using software on the website of the Department of Chemistry, Central Connecticut State University (http://db.systemsbiology.net:8080/proteomicsToolkit/IsotopeServlet.html). To compensate for the differences in ORF lengths of Ara h 2 and Ara h 6, the percentage values were used in determining side chain compositions. We followed Kyte and Doolittle (1982) [41] in assigning amino acids to their respective five groups: Hydrophilic and Uncharged: H, N, Q, S, T; Hydrophobic: A, C, G, I, L, M, P, V; Aromatic: W, Y, F; Charged, Acidic: D, E; Charged, Basic: K, R. The means, standard deviations and statistical p values for significance of difference were calculated in Microsoft Excel version 15.36, 2017.
Sequence identity
The SIAS software of the Immunomedicine Group, Universidad Complutense, Madrid (SIAS, http://imed.med.ucm.es/Tools/sias.html) was used for the sequence identity analyses of nucleotide and amino acids. The Sequence Identity (ID) module calculates pairwise sequence identity percentages from multiple sequence alignments using the equation: ID = Identical Residues/Sequence Length x 100. Aligned matrices were used as input files and the Smallest-Length Sequences option was chosen. Gaps were included in the computations.
Assessment of molecular evolution
To assess potential signature of natural selection on Ara h 2 and Ara h 6, three metrics were used and compared for evidence of selection pressure signature. In one, we used the proportions of synonymous (dS) and nonsynonymous (dN) mutations as an estimated measure of ω as computed in SNAP [42]; www.hiv.lanl.gov). This computation follows the distance-based method of Nei and Gojobori (1986) [43] which estimates the numbers of dS and dN substitutions per site implementing equal weight for all codon substitutions, and incorporates a statistic developed by Ota and Nei (1994) [44]. Computed here are average behaviors of each codon in pairwise comparisons for indels, synonymous and nonsynonymous mutations.
We further explored two other matrices using HyPhy as implemented in Datamonkey portal (http://www.datamonkey.org): one assesses selection at a gene-wide scope while the other determines selection signatures at a per-site level. BUSTED (Branch-Site Unrestricted Statistical Test for Episodic Diversification [45] was used to test for gene-wide (not site-specific) positive selection. All branches in the tree were selected as the foreground for testing natural selection on the entire phylogeny. BUSTED fits a codon model with three rate classes (ω1 ≤ ω2 ≤ ω3, unconstrained model) and tests for positive selection against a constrained null model (ω = 1, disallowing positive selection) on the foreground branches. We used FUBAR (Fast, Unconstrained, Bayesian Approximation [46] to test positive and negative selection at a per-site basis. FUBAR uses the Bayesian algorithm and the posterior probabilities to infer dN and dS on a per-site basis using a provided phylogeny. The method assumes that selection pressure at each site is constant along the entire phylogeny. Maximum likelihood analysis was carried out using RAxML and executed in the CIPRES portal (www.phylo.org) implementing the default options. The phylogeny generated was used in the above analyses for testing evidence of natural selection. Since we do not have sequences for an outgroup species to root the tree, we opted to use A. macedoi for rooting the tree because it emerged at the base of the Arachis phylogeny in the Friend et al. 2010 study [33].
Characterization and structural modeling of Ara h 2 and Ara h 6
Secondary structure prediction and analysis was performed for all Ara h 2 and Ara h 6 sequences via the PSIPRED Protein Sequence Analysis Workbench [47]; (bioinf.cs.ucl.ac.uk/psipred). Prediction methods utilized include PSIPRED v.3.3, DISOPRED3, DOMPRED, and FFPred v3. This analysis suite provided insight into secondary structure and function prediction, disordered regions, and disordered protein binding regions for all sequences.
Homology models were generated for A. hypogaea 2.01 and 2.02, and A. triseminata in order to map the predicted epitope regions to structure. We chose to model the two isoforms Ara h 2.01 and Ara h 2.02 to represent the allergenic components of the peanut crop and selected A. triseminata because of its basal phylogenetic position and lack of the immunodominant epitopes. Conformer 1 of the NMR structure of Ara h 6 from A. hypogaea was used as template (PDB ID: 1W2Q, [37]). We opted to use the Ara h 6 NMR structure despite the availability of a crystal structure for Ara h 2 because the Ara h 2 crystal structure (PDB ID: 3OB4) is based on a fusion of maltose binding protein (MBP) with Ara h 2 and lacks the region containing epitopes 6 and 7 of this allergen. This immunologically important region is present in the NMR structure of Ara h 6. The missing residues in the Ara h 2 crystal structure (see PDB ID: 3OB4, 1057–1083 missing residues) were essential to our analysis of epitopes 6 and 7, which was a factor that influenced our template choice. An overlay of the available template structures and the model created are shown in the supplemental material and highlight the influence of the missing residues of epitope 6 and 7 on the Ara h 2 model structure, further justifying the selection of the Ara h 6 template for generating the model. Barre (2005) [15] and Power (2012) [48] generated homology models of Ara h 2 using the castor bean allergen Ric c 3 as template, but Mueller et al. (2011) [49] illustrated that Ara h 2 is a better structural match to Ara h 6 than to the Ric c 3 allergen, thereby further validating our approach.
The homology models of A. hypogaea Ara h 2.01 and Ara h 2.02, and A. triseminata were built and energy minimized in Molecular Operating Environment (MOE) [50] with Amber12EHT [51] parameters and validated with ProSA [52], Ramachandran plots [53], ANOLEA [54], and QMEAN using ProSA-web [55], RAMPAGE [53], and the SwissModel [56] suite of tools. We are confident in the models given the structure validation analysis metrics showed that all three models had favorable energy throughout most of the proteins based on ANOLEA, with minimal regions of unfavorable energy in the N-terminal region and in loop regions (residues 50–60, 115–120). Ramachandran plots indicated most residues had favorable dihedral angles (A. hypogaea 2.01–98%, A. hypogaea 2.02–76%, and A. triseminata - 78%). Overall protein structure z-scores, which consider torsion, side chain position, and overall fitness, fell into a range that indicated a similarity to known, high-quality NMR protein structures for all three structures. To relate potential tertiary structure and epitope placement, we used DiscoTope 2.0 [57] to predict linear and conformational epitopes based on the 3D structures of Ara h 2 from A. hypogaea Ara h 2.01 and Ara h 2.02, and A. triseminata [58, 59]. DiscoTope predictions combine computational methods proposed by Nishikawa and Ooi (1980) [60] to measure the amino acids located at the protein surface. Additionally, the NACCESS program [61] has been incorporated with DiscoTope to determine the residues that are accessible to the solvent.
Dot immunoblots for epitopes of conglutin proteins
Seven peanut-allergic and four non-allergic subjects (18–34 years old) were recruited. Serum samples were isolated by centrifugation at 3000 rpm for 10 min from the 10 mL of whole blood donated by subjects and stored at -80° C until use. Among the 10 IgE-binding epitopes identified for Ara h 2 [14], epitopes 6 and 7 contain the immunodominant DPYSPS motif, and thus we focused on these two epitopes in this study. We generated 15–18 oligomer peptides (GenScript, Piscataway, NJ) to represent the portions with the DPYSPS motif or its variants. As a control, we used purified Ara h 2 protein derived from A. hypogaea contributed by Soheila Maleki (USDA, New Orleans, LA). Hydrated peptides were spotted directly onto Protan nitrocellulose membrane and allowed to dry. Dot immunoblots were incubated in 5% non-fat milk in Tris-buffered saline with 0.5% Tween-20 (TBS-T; pH 7.5) for one hour at room temperature with shaking. The blots were incubated overnight at 4°C in either 1 : 6000 diluted chicken α-Ara h 2 antibody or in 1 : 20 diluted sera from peanut allergic individuals and washed three times with TBS-T for 10 min after antibody incubation. The dot immunoblots probed with chicken α-Ara h 2 antibodies were subsequently incubated with rabbit anti-chicken IgG horseradish peroxidase (HRP)-conjugated antibodies (1 : 2500; Bethyl Laboratories Inc., Montgomery, TX) for one hour at room temperature. The immunoblots incubated with human sera were incubated with rabbit anti-human IgE HRP-conjugated antibodies (1 : 1000; Bethyl Laboratories Inc.). ECL Plus detection reagents were used for the HRP-conjugated secondary antibodies for chemiluminescent detection with a Fuji LAS-300 camera using the FUJIFILM Multi Gauge version 3.X.
Results and discussion
Since our knowledge on peanut allergy has been limited to the crop species and its two genomic ancestors, and considering the findings that single amino acid substitutions could have substantial impact on allergenicity [14, 31, 32], it is pertinent to explore single amino acid substitutions in the wild species of Arachis and evaluate their impact on allergenicity. To do so, we sequenced the two immunodominant allergens Ara h 2 and Ara h 6 from 24 species representing the major lineages in Arachis and used multiple approaches to characterize molecular alterations and determine their impact on allerginicity. Three striking outcomes from this study have emerged. One, the two allergen homologues studied, Ara h 2 and Ara h 6, followed very contrasting evolutionary pathways. Specifically, Ara h 2 has undergone a higher proportion of amino acid substitutions compared with Ara h 6 and has accumulated by far a greater number of losses and gains of motifs ranging from 1–24 amino acids (S1 Fig). Two, and quite importantly, these molecular alterations were mostly concentrated in the immunodominant epitope-rich regions, specifically in Epitopes 6 and 7 (Fig 2, S1 Fig). Three, the mutational events (substitutions and insertions/deletions) particularly in Ara h 2 appear to follow phylogenetic trends from the base of the Arachis tree to the terminal branches. These findings raise the questions of the underlying factors that differently affected Ara h 2 and Ara h 6 modes of evolution and whether such molecular alterations are linked to potential accentuation of allergenicity. To address this curious biological situation, we will compare the two homologues at various molecular tiers and discuss the findings in a phylogenetic/evolutionary framework.
Fig. 2. Ara h 2 amino acid alignment section containing the immunodominant epitopes 6, 7 and 7b. Gaps and epitopes are labeled. Numbers above the columns denote alignment positions. Comparative molecular composition across the genus Arachis
One of the prominent findings in this study is that Ara h 2 and Ara h 6 homologs from wild Arachis species differ substantially in mutational patterns and ORF length. To shed light on the underlying factors that might account for these differences and assess the impact of this contrasting mode of evolution on these proteins, we evaluated molecular compositions at two tiers: nucleotide and amino acid levels. The nucleotide compositions for the entire ORFs of Ara h 2 and Ara h 6 homologs as well as the nucleotide frequencies per codon position are presented in Fig 3. Overall, the two homologues did not differ significantly in their nucleotide composition across the genus since the t-test rejected the null hypothesis. This underscores notable constraints on their mode of nucleotide substitutions to maintain similar compositions.
Fig. 3. Average percentages of Adenine (A), Thymine (T), Guanine (G), Cytosine, and GC ratios. Calculations were done for overall DNA sequences and individual codon positions of Ara h 2 and Ara h 6 from the Arachis species. The notations 1, 2 and 3 denote 1st, 2nd, and 3rd codon positions. Data are presented as mean ± SD. A two-way ANOVA with Sidak post-test was applied. The two homologues were not statistically different in nucleotide composition. It has been demonstrated that higher GC content correlates positively with rates of substitutions [62, 63]. A recent study focusing on A. duranensis estimated an average GC content of 31.8% for the whole genome, which is in line with most legumes examined [9]. The overall GC ratio for both homologues was highly similar (Ara h 2 = 55.7± 0.8 Ara h 6 = 56.1± 0.5, (Fig 3). The average 56% GC content of Ara h 2 and Ara h 6, being substantially higher (75%) than that reported for the whole A. duranensis genome points to a suitable genetic landscape for accelerated rates of mutations in both. Nevertheless, the frequency of amino acid substitutions remained lower in Ara h 6. One notable difference is that Ara h 2 exhibited relatively higher GC ratios in its 1st and 2nd codon positions contrasted with Ara h 6 (Fig 3). This difference may account in part for the elevated amino acid substitutions in Ara h 2 since mutations in 1st and 2nd codon positions are translated into 96% and 100% nonsynonymous substitutions, respectively, compared with 31% for the 3rd position [64].
The two homologues, although being highly allergenic, display disparity in their number and modes of amino acid substitutions (Fig 4, S1 Fig). Reciprocal amino acid sequence identities for Ara h 2 across the Arachis species ranged between 65.5% to 99.4% (mean 89.4%± 8.2) compared with 75.7%-99.3% for Ara h 6 (mean 93.2%± 5.3), underscoring the higher frequency of substitutions in the former. In the case of Ara h 2, the ORF length ranges from 156 to 181 amino acids (S1 Table). The amino acid alignment of Ara h 2 required the insertion of 17 gaps ranging from 1 to 29 amino acids, resulting in 203 alignment positions (S1 Fig). Importantly, amino acid positions 59–90 in epitope 5 and the immunodominant epitopes 6, 7 and the newly recognized 7b display residue substitutions and losses/gains that may potentially impact allergenicity (Fig 2). Thirteen gaps in the sector that includes epitopes 6, 7 and 7b are identified and labeled A-L (Fig 2). The mutation in position 64 presents a molecular marker for the genomic ancestry of the tetraploid crop since it is a glycine (G) in all three accessions of A. ipaensis and glutamic acid (E) in all A. hypogaea and A. duranensis accessions (Fig 2).
Fig. 4. Percent deduced amino acid composition of Ara h 2 and Ara h 6 proteins from the Arachis species. A two-way ANOVA with Sidak post-test was applied. All data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p<0.0001. The Ara h 6 ORF, in comparison, displayed a narrower range of amino acid residues across the genus, 145 to 147 (S1 Table). Only two sequence gaps were required for the alignment, corresponding to a methionine at position 22 and an arginine at position 69 (S1 Fig). Interestingly, this apparent in-frame initiation codon at position 22 evolved in species that emerged after the early diverging A. triseminata, A. paraguariensis and A. macedoi. This methionine residue could not be considered as an alternate initiation codon since it occurs downstream of the signal peptide region. Remaining amino acid differences were due to replacements, underscoring the contrasting patterns of evolution undergone by Ara h 2 and Ara h 6 across the genus. The infrequent loss/gain of amino acid residues in Ara h 6 across the genus Arachis compared with Ara h 2 is intriguing and could be attributed to structural/functional limitations on this allergen protein.
To assess potential heterogeneity in amino acid composition across the Arachis genus evolutionary history due to the noted mutational events, we analyzed amino acid compositions of the Ara h 2 and Ara h 6 homologs. The two were comparable in amino acid composition across the genus, and were low in tryptophan (W) and high in arginine (R) and glutamine (Q) (Fig 4 and S2 Table). These findings are in agreement with previous studies on peanuts [65]. Tryptophan was lacking in Ara h 2 of three species and the Ara h 6 of 14 species (S2 Table). It is observed that Ara h 2 accommodated higher variation across the genus Arachis in glutamine (Q), proline (P), and aspartate (D), whereas Ara h 6 displayed higher variation in glutamate (E), histidine (H) and arginine (R) (S2 Fig and S2 Table). Despite the contrasting patterns of variability, the two homologues are similar in composition in terms of the five amino acid physicochemical groups and they are rich in hydrophobic amino acids and low in aromatic amino acids (Fig 5). Therefore, mutational events in the two homologues appear to be constrained to maintain the physicochemical groups composition in order to conserve the functional and structural integrity of these proteins.
Fig. 5. Percentages of side chain composition of deduced amino acids in Ara h 2 and Ara h 6 proteins. The means, standard deviations (noted as bars) and the statistical p values for significance of difference were calculated in Graphpad Prism. A two-way ANOVA with Sidak post-test was applied. The two homologues were not statistically different in sidechain compositions. The hydrophobic nature of the protein is important for the functionality of the signal peptides of these allergens [30]. Ara h 2 and Ara h 6 are synthesized in the cytoplasm as precursor proteins with an additional N-terminal amino acid signal peptide required for transport to the vacuoles [19, 30, 66]. The signal peptides (amino acid residues 1–7 [29] or residues 1–21 [67] contain 2-residue gaps in Ara h 2 and display a number of substitutions in both Ara h 2 and Ara h 6 (Fig 6 and S1 Fig). Despite these mutations, the region remained highly constrained to maintain the hydrophobic physicochemical property required for its crucial function (S1 Fig). In summary, although the two allergen proteins have undergone contrasting patterns of amino acid substitutions and losses/gains over the evolutionary history of the genus, they maintained comparable amino acid composition and physicochemical groups.
Fig. 6. SNAP analysis of Ara h 2 and Ara h 6 amino acid sequences. Shown are a per-codon distribution of synonymous mutations (red), nonsynonymous mutations (gray) and indels (blue). IgE-binding epitopes are highlighted beneath the amino acid residues. 5A. Ara h 2 homologue. 5B. Ara h 6 homologue. Signatures of natural selection in Ara h 2 and Ara h 6
The contrasting mutational patterns observed in Ara h 2 and Ara h 6 (Figs 4 and 6, S1 Fig) raise the question of whether these evolutionary modes are driven by natural selection, positive-diversifying or negative-purifying. Assessment of signatures of natural selection operating on coding genomic regions is a major challenge. Murrell et al. (2015) [45] noted that there is not yet an uncontroversial way to answer the question of whether a gene evolved under positive selection. Underlying factors that contribute to the difficulties in determining positive selection signature include intrinsic patterns of gene substitutions, biological assumptions made, and models used. To assess potential natural selection signatures acting on Ara h 2 and Ara h 6, given the prominent differences in mutational patterns, we selected and contrasted results of three independent methods (distance–based, BUSTED, and FUBAR) that adopt different biological assumptions and use metrics for site-specific or whole gene estimation of natural selection signatures.
One of the simplest methods is that of Nei and Gojobori (1986) [43] that focuses on the detection of natural selection using the rates of synonymous vs. nonsynonymous substitutions in protein coding genes. The algorithms compute variance and covariance of dS (synonymous) and dN (nonsynonymous) mutations and the proportions of synonymous (pS) and nonsynonymous (pN) differences. Using SNAP for these computations, the averages of all pairwise comparisons for the Ara h 2 data set showed dS = 0.0142, dN = 0.0475, dS/dN = 0.3319, and pS/pN = 0.3379. In contrast, the Ara h 6 data set revealed dS = 0.0831, dN = 0.0247, dS/dN = 5.8627, and pS/pN = 5.5914. The 0.332 dS/dN for Ara h 2 implies that it has experienced positive selection along the genus evolutionary history whereas the 5.863 dS/dN calculated for Ara h 6 indicates purifying selection. A dS/dN value below 1 implies positive/diversifying selection while above 1 signifies purifying selection (SNAP output is presented as dS/dN not dN/dS). BUSTED, a gene-wide and positive selection-focused method, reported evidence of gene-wide episodic diversifying selection in Ara h 2 across the branches of the phylogeny (p = 0.005 ≤ 0.05) but no evidence of episodic diversifying selection in Ara h 6 (p-value = 0.151 ≥ 0.05). Therefore, the BUSTED finding is in agreement with the Nei and Gojobori (1986) approach, with both showing that Ara h 2 is experiencing positive selection. Ara h 6, on the other hand, was shown to be under purifying selection using Nei and Gojobori (1986) approach (BUSTED tests for positive selection).
The site-specific, Bayesian-based FUBAR method detected in Ara h 2 diversifying selection and purifying selection at 5 sites each with 0.9 posterior probability. For Ara h 6, this method detected diversifying selection at 2 sites but purifying selection at 8 sites (posterior probability 0.9). The detected sites are highlighted in S3 Table. FUBAR (Murrell et al. 2013) [46] has more power for detecting weak positive selection (at low ω>1 values). Contrasting the gene-wide and the site-specific methods used here, it is believed that the gene wide methods are more effective in detecting natural selection signatures. Murrell et al. (2013) [46] noted that when positive selection is undetectable on any one codon site or branch in isolation, pooling evidence for positive selection across multiple sites and branches can render their cumulative effect more evident. Similar inferences were reached by others [68, 69]. This seems to be the case in the detection of positive selection by the gene-wide methods used in this study. In conclusion, the gene-wide approaches have shown that Ara h 2 is evolving under positive/diversifying selection. The Nei and Gojobori (1986) [43] and the FUBAR approaches (BUSTED tests for positive-selection) demonstrated that Ara h 6 is evolving under negative/purifying selection. FUBAR detected sites under positive selection in both Ara h 2 and Ara h 6 but more sites under purifying selection in Ara h 6 (2 vs. 8 sites, respectively). These findings raise the curious questions of whether positive selection in Ara h 2 played a role in the emergence of immunodominant motifs, whereas purifying selection in Ara h 6 maintained a status que for a gene that has emerged initially with strong allergenic features when Arachis diverged from its common ancestry.
To evaluate the potential consequences of the positive selection detected in Ara h 2, two concepts will need to be addressed. One relates to the detection of progressive increase in allergenicity across the evolutionary history of the genus and the other pertains to its potential adaptive advantages for allergenicity. Insight into the relationship between the progressive expansion of the region encompassing the immunodominant epitopes 6, 7 and 7b, including the progressive additions of DPYSPS motifs in Ara h 2 (Fig 2) and the enhancement of allergenicity is provided by the immunoblot experiments. These experiments (detailed later) revealed a progressive increase in allergenicity from the basal species A. triseminata to the terminal species in the phylogenetic tree, A. hypogaea. The changes correspond to expansions of the immunodominant motifs region (Fig 2), pointing to a possible association between the two phenomena. The second point to be addressed is the availability of evidence for adaptive advantages allergenicity may confer on peanut seeds. Direct experimental studies addressing this question in the wild species of Arachis are unavailable in the literature. However, some work exists that links the allergen proteins to defense against insects and pathogens. Ara h 2 is a trypsin inhibitor [7] and this function has been shown to control insect attacks, a feature that is being used in breeding programs for insect tolerance during seed storage [70]. The 2S albumin protein family, to which Ara h 2 and Ara h 6 belong, was demonstrated to be effective in inhibiting the growth of fungi and bacteria in radish seeds and four other members of the mustard family Brassicaceae [71]. Similarly, antifungal properties are known for a 2S albumin-homologous protein from passion fruit seeds [72]. Considering these findings in peanuts and other flowering plants, positive/diversifying selection pressure that promotes the augmentation of allergenicity may be advantageous to increase the chances of seed survival via protection from insects and fungi. The patterns of molecular evolution documented in Ara h 2 and the corresponding progressive increase in allergenicity resolved in the immunoblots encourages direct studies on wild species seeds to evaluate selective advantages for protein allergenicity.
Phylogenetic and evolutionary assessment of epitopes
The pattern of substitution (mutations and indels), particularly nonsynonymous substitutions, could have dual structural and functional implications in protein coding genes. In allergen genes, nonsynonymous substitutions in epitope-rich sections or duplications of allergenic epitopes may substantially impact allergenicity [14, 17, 30]. It has been shown in peanuts that a single residue substitution expresses up to 99% reduction in allergenicity by impacting the IgE-binding ability [14, 31, 32]. We will discuss within a phylogenetic platform the mutational events in the allergenic epitopes of the two homologues. Identification of the Ara h 2 and Ara h 6 epitopes across the genus is based on epitopes recognized in the crop and its putative ancestors by Staley et al. (1997) and Ratnaparkhe et al. (2014) [14, 29].
The Ara h 2 homologue
Ten epitopes have been recognized in Ara h 2 [14]. Epitopes 6 and 7 are unique to this homologue and contain the characteristic immunodominant hexapeptide DPYSPS motif (Fig 2 and S1 Fig) located between helices 2 and 3. The other eight epitopes are split among the upstream region (epitope 1–5) and the downstream regions (epitopes 8–10). Epitope 1–4 (HASARQQWEL, QWELQGDR, DRRCQSQLER, LRPCEQHLMQ, respectively), and epitopes 8–10 (LQGRQQ, KRELRN, QRCDLDVE, respectively) are completely to highly conserved across Arachis (S1 Fig). Epitope 5 (KIQRDEDS), in contrast, has undergone complex mutational events. Although its KIQR motif is unchanged throughout the genus, the remaining sector (DEDS) has accommodated a number of mutations and indels across the genus history, appearing as DQD-Q and DED-S (dashes denote gaps) in the basal clade of A. macedoi, A. lutescens, and A. triseminata, mutating to DQS—, EED-Q, DEDSS in species of subsequent lineages, and reverting back to the original sequence of DED-S in the crop and its related species of the terminal lineage (Fig 1 and S1 Fig). It is to be noted that the early diverging A. triseminata with the truncated DQS—motif displayed the lowest degree of allergenicity in our immunoblot experiment compared with the peanut (Fig 7, discussed below). These natural mutations have the potential of providing valuable guidelines for examining the impact of loss/gain and residue mutations on allergenicity.
Fig. 7. Dot Immunoblot for sera from peanut-allergic individual used to test peanuts crude protein extract (Peanut CPE), purified Ara h 2 protein, and synthetic peptides containing the hyperallergenic epitopes 6 and 7. Dot immunoblot on a nitrocellulose membrane strip is shown at the bottom and its densitometry measurements are represented as bars above the respective antigens with absolute absorption shown above bars. The synthesized polypeptides used were: A. hypogaea: RDPYSPSQDPYSPS, A. batizocoi RDPYSPSQDPYKQDP, A. glandulifera DPDRQDPYSPSQDPD, A. guarantica EQDPYRQDPYGPSPYG, A. rigonii EQDPYGPSPYGPSPY, A. triseminata QSPYSQDPYRQEPYE. Epitopes 6 and 7 (RDPYSP and SQDPYSPS, respectively) contribute significantly to Ara h 2 allergenicity [14]. We recognize within downstream epitope 7 another RDPYSPS motif (positions 84–90; Fig 2), a potential additional IgE-binding epitope, denoted epitope 7b. This motif was noted before but not recognized as an epitope [28, 30]. The three epitopes 6, 7, and 7b could have evolved via sequence duplications accompanied by SNPs. It has been reported that more than one motif of DPYSPS in the gene could present allergenic risk [17] and, therefore, the presence of three motifs would accentuate peanut allergy. Importantly, the region encompassing these three epitopes is punctuated with gaps and point mutations across the Arachis, revealing a progressive evolution of the three immunodominant epitopes and allergenicity in peanuts (Fig 2).
It is rather intriguing that in the first emerging clade (Section Extranervosae, Fig 1), A. macedoi lacks all three epitopes (Gaps E and K) whereas its sister species A. lutescens possesses epitopes 6 and 7b (Gap H, Fig 2, S1 Fig). A parsimonious explanation here is that 1) the presence of epitopes 6 and 7b is an ancestral state whereas their loss is a derived one, and 2) epitope 7 is a subsequent derivation from them. All three epitopes were lacking except for a few residues (Gaps G, H, I) in the next emerging species A. triseminata (Figs 1 and 2), whereas in the following clade, A. pintoi (Section Caulorrrhizae), only epitope 7b is maintained (Gaps E, F). The species of the next major lineage, Group Erectoides (Fig 1), again displayed a variety of losses, gains and SNPs that eliminated or modified these epitopes (Fig 2). Various residue losses (Gaps C, D, E, G) and amino acid mutational events either eliminated, truncated or highly modified epitope 6 (Figs 1 and 2). Losses and gains of these immunodominant epitopes early in the evolution of the genus could have had impact on allergenicity and, thus, present an excellent material for studying the molecular basis of allergenicity in peanuts. These molecular evolutionary scenarios in Ara h 2 point to the existence of allergenicity at the advent of the genus Arachis albeit at relatively lower magnitudes.
The Ara h 6 homologue
Ara h 6 accommodates only two, single amino acid residue gaps in the entire ORF located at amino acid residue positions 22 and 69 (S1 Fig). The gap at position 22 corresponds to a lack of a methionine in early-diverging A. triseminata, A. macedoi and A. paraguarensis (Fig 1, S1 Fig). As noted earlier, this methionine insertion is not expected to be involved in the transcription of the ORF since it will eliminate the crucial signal peptide region.
Ara h 6 lacks the hexapeptide DPYSPS immunodominant motifs found in Ara h 2 and consequently, only eight epitopes have been recognized, 1–5 and 8–10 (S1 Fig). Epitope 1 (HASAMRRERGRQG) contains some conserved sections and others that experience mutations (Fig 6 and S1 Fig). Epitope 2 (ERGRQGDSSS) is highly conserved and epitopes 3, 4, 8 and 9 (DSSSCERQVDR, LKPCEQHIMQRI, RLQDRQMVQQ, and KRELMNLPQQ, respectively) remained entirely unchanged across the genus (S1 Fig), pointing to their structural and functional significance. In contrast, epitope 5 (RIMGEQE) exhibited substitution events in early diverging lineage followed by reversals in terminal lineages including the peanut species. Epitope 5 pattern mirrors that in Ara h 2. In epitope 10 (QRCDLDV), the first two N-terminal residues in the basal species A. macedoi, A. triseminata and A. paraguariensis (Fig 1 and S1 Fig) differ from the QR motif found consistently in species emerging upwards in the Arachis phylogenetic tree. It would be useful to investigate if these residue mutations and subsequent reversals from the early diverging species to the terminal ones signify possible selection to maintain allergenicity.
The peanut crop and its ancestral species
Our sequence data and those in GenBank show two variants of Ara h 2 in the diploid A. ipaensis (Fig 2). In one variant, epitope 7b lacks the DPYSPS motif (Gap A, residues 79–90) plus five upstream residues (GB accession XM_016314981.1) whereas in the other variant that whole region was maintained (XM_016314980.1 and ours). Since the peanut crop inherited two alleles of Ara h 2 with and without epitope 7b, and one progenitor, A. duranensis, lacks this epitope, it appears that the Ara h 2.02 allele was contributed by the A. ipaensis genotype possessing epitope 7b. It is rather remarkable that such a loss of a region containing an important allergenic epitope can take place in sister species within a relatively short historic time. Nevertheless, species containing all three epitopes (6, 7, and 7b) with their DPYSPS motifs represent an evolutionary climax of allergenicity in Arachis, which ironically is what we detect in the peanut crop. In conclusion, the prevalence of pronounced natural mutations in this sector of Ara h 2 provides insight into the link between amino acid mutations and allergenicity and encourages efforts of experimental genetic manipulation of allergenic regions in the crop.
Immunoblot for Ara h 2
Given the pronounced differences in epitope composition among the Arachis species and its known strong allergenicity, Ara h 2 was further probed for allergenic response based on pronounced mutational events that partially or completely eliminated some of its epitopes including the highly allergenic DPYSPS motif. We selected species from across the phylogenetic tree to assess within a phylogenetic background the impact of these major genetic transformations in Ara h 2 on allergenicity using the immunoblot approach (Fig 7). The results from immunoblots probed with the various human peanut allergy-sensitive sera collected were highly similar and thus the dot immunoblot probed with sera from PA-5 was chosen as a representative. Variation in signal was most noticeable with the 40-ng application, which was analyzed quantitatively using densitometry (Fig 7). When the background was subtracted from the densitometry reading, three categories of antibody recognition signal intensities were apparent in comparison to the peptide representing the H2-H3 loop from A. hypogaea: 1) 50% or less was considered to possess low antibody binding affinity, 2) 51–75% was considered intermediate, and 3) 76% and above was regarded to have high affinity.
As expected, crude protein extract (CPE) from A. hypogaea, the purified Ara h 2 protein, and the synthetic polypeptide representing part of the loop containing the DPYSPS motif from A. hypogaea homologue were highly recognized (Fig 7). On the other extreme, A. triseminata displayed the lowest IgE-binding ability, 30% of the A. hypogaea signal. This could be attributed in part to its lack of the DPYSPS-containing epitopes. The reduction in IgE-binding ability (Fig 7) in A. guaranitica (50.6% of the isolated Ara h 2 protein and 69.4% of the A. triseminata) can be attributed to the presence of only one epitope, 7b (Fig 2). Although both A. glandulifera and A. batizocoi possess two DPYSPS-containing epitopes, the former possesses epitope 7 and 7b whereas the latter has epitopes 6 and 7b with an S mutated to T. The difference in reactivity (Fig 7) may imply that these epitopes have different magnitudes of allergenicity that are further influenced by residue substitutions. The immunoblot findings, which focused on the immunodominant epitopes, are in line with the [17] observation that the presence of more than one motif of DPYSPS in Ara h 2 could present allergenic risk. Further, these findings demonstrate that it is not a mere additive effect that influences allergenicity, but also the differential impact of newly added epitope. Our homology modeling of these epitopes revealed different lengths of predicted disordered structure for them that further supports such variation in immunoreactivity, as will be described below.
Epitope prediction and homology modeling
A variety of sequence and structure prediction tools were applied to the Ara h 2 and Ara h 6 homologues in this study to further connect sequence to structure to epitope presence. These tools provided information on disordered regions, IgE binding regions, and secondary structure, allowing us to assess sequence identity/similarity and the location of sequence motifs of known epitopes (Fig 8 and S3 Fig). This sequence and structural information was considered in light of the experimental reports of the epitope positions on these proteins, particularly the immunodominant epitopes 6 and 7 [14, 29]. Analysis of the sequence-based structure using PSIPRED predictions for all species included here showed the DPYSPS sequence motif in epitope regions 6 and 7 has different lengths of predicted disordered structure that further supports the variation in immunoreactivity observed experimentally in the dot blots. This conclusion is based on the structurally disordered epitopes being more efficient at binding antigens [73] and that PSIPRED predicts both disordered protein regions and disordered protein binding regions.
Our sequence-based epitope prediction demonstrates that the absence of DPYSPS epitopes results in fewer residues having disordered or protein binding structure whereas the presence of one DPYSPS motif (e.g. epitope 6) increases the number of predicted residues involved in protein binding or disordered structure. It was also observed that the start of epitope 6 at position 65 and the presence of multiple DPYSPS motifs (species containing all epitope 6, 7, and 7b) had the largest number of residues involved in disordered structure and protein binding regions, suggesting high allergenicity. A lack of epitope 6 in A. trinitensis, A. glandulifera, A. praecox, A. palustris was predicted to result in moderately allergenic protein given the length of predicted disordered and protein binding residues. Lastly, species in Group Erectoides and Section Trisminiatae (A. macedoi, A. guaranitica, A. appressipila, A. paraguariensis, A. dardani, A. tuberosa, and A. triseminata) lack the DPYSPS motif but contain a DPY(G or T)PS motif. Their sequence-based structure and epitope prediction suggest that they are less allergenic than the other species. Taken together, results of sequence-based epitope prediction showed these regions to be epitope and/or disordered protein regions that impact allergenicity (Fig 8 and S3 Fig).
Fig. 8. Homology models of allergenic homologues colored based on DiscoTope prediction. (A) A. hypogaea 2.01, (B) A. hypogaea 2.02, and (C) A. triseminata. Predictions are illustrated as a heatmap on the protein surface: Red = high prediction score and Blue = low prediction score. The region representing epitopes 6, 7, and 7b is highlighted. Arachis hypogaea has more red designation predicted by DiscoTope in this region and less helical structure, indicating more potential for binding IgE. (D) is homology model of A. hypogaea 2.01 with epitopes mapped: epitopes 1–3 (dark blue), epitope 4–5 (green), epitope 6–7 (cyan), epitope 8–9 (red) and epitope 10 (pink). Structure is rendered in the same orientation as A and B. Our three-dimensional models of the Ara h 2 structure demonstrate that the dominant epitopes are located on surface loops (Fig 8), and consequently are more accessible for IgE binding. Models were generated and validated using the NMR structure of Ara h 6 from A. hypogaea as a template (PDB ID: 1W2Q, [37], the rationale for which was presented in Materials and Methods. Our Ara h 2 homology models revealed an overlap with Ara h 6, showing structural similarity in the core and in an extended loop region in a position similar to the Ara h 2 loop region containing epitopes 6 and 7 (aligned root-mean-square deviation (RMSD) of structures was 3.4 Å). As noted earlier, an overlay of the Ara h 2 structure from homology modeling with the MBP bound crystal structure of Ara h 2 showed the latter structure missing a major loop region containing epitope 6 and 7, a region essential to our immunological-focused study (S3 Fig), which was a major factor in selecting the Ara h 6 NMR structure as template. An alignment overlay of the Ara h 2 x-ray structure from PDB ID: 3OB4 was performed with the Ara h 2 model of A. hypogaea and had an RMSD of 3.7 Å, while an alignment overlay of the Ara h 2 x-ray structure (PDB ID: 3OB4) and Ara h 6 NMR structure (PDB ID: 1W2Q) had an RMSD of 2.3 Å. Collectively, all structures (model, templates) have conserved helical domains, indicating the representation of major Ara h 2 template structure components in the model, while allowing for additional modeling of the loop region containing epitopes 6 and 7 from the Ara h 6 template structure selection.
Epitopes on antigens are distinguished from the remainder of the surface in properties such as amino acid composition, secondary structural composition, and evolutionary conservation [74]. With regard to amino acid composition, epitopes are enriched in tyrosine and tryptophan, and have a general preference for charged and polar amino acids. The sequence DPYSPS contains residues meeting those properties. Rubinstein et al. (2008) [74] noted that epitopes are not enriched in proline residues. However, proline residues contribute to disordered structure, which is common in epitopes. Bernard et al (2015) [17] observed that IgE binding to Ara h 2 was enhanced by Ara h 2 peptides containing three proline-contacting DPYSPS motifs compared to Ara h 2 peptides containing only two motifs.
Sequence and structural data for Ara h 6 relative to antigenicity are less clear, one reason being the paucity of data related to immunoreactivity of the Ara h 6 homologue. Sequence based epitope analysis of Ara h 6 suggests several linear epitopes within the structure [29, 75], with some of these being homologous to epitopes in Ara h 2. The relationship of these epitopes to structural features is less clear. For example, a large loop extending from residues 55–71 in the three-dimensional structure of Ara h 6 is predicted to be disordered, containing the linear epitope YDSYDIR, but this epitope does not appear to be strongly immunoreactive based on our sequence-based epitope prediction. Regions from residues 80–90 and 94–106 also are reported to be immunoreactive, but structural prediction data indicate a low probability for disorder, and the NMR three-dimensional structure reveals these regions to contain coil structure interrupted by helices (S3 Fig). The C-terminal region of Ara h 6 is predicted to be disordered as observed in the three-dimensional structure, which is consistent with the immunoreactivity of this region [45]. While lacking the DPYSPS motif, Ara h 6 is still among the most allergenic epitopes in peanuts [1,17] despite a lack of difference in disordered protein regions across the species as compared to Ara h 2.
Conclusions
This study is the first in-depth exploration of Arachis wild species for naturally occurring genetic alterations in genes encoding allergen proteins. It has been demonstrated that experimentally induced targeted mutations in peanuts reduce allergenicity significantly [14, 15, 31]. Focusing on the highly allergenic Ara h 2 and Ara h 6, we uncovered a wealth of point mutations and indels. Importantly, the mutations in Ara h 2 are concentrated mostly in the immunodominant epitope region. Our immunoblot experiments and protein structure prediction demonstrated that mutations appear to be associated with substantial reductions in allergenicity in Arachis species. Consequently, these genetic mutations not only provide valuable insight into interaction between mutation type/positioning, protein structure and allergenicity, but also represent cost-effective raw material for experimental work aiming at reduction/elimination of allergenicity and possibly usage in human therapy treatments.
What particularly stood out is that molecular alterations to the allergens ORFs was substantially skewed towards Ara h 2, pointing to a contrasting mode of gene evolution that differentially impacts the allergenic proteins. Considering that protein products from both Ara h 2 and Ara h 6 are immunodominant, their contrasting modes of substitutions and gain/loss of amino acids raise questions concerning the driving forces directing their distinct evolutionary pathways across the genus history. We found different modes of natural selection operating on the two homologues, with Ara h 2 being under positive diversifying selection while Ara h 6 is under purifying selection. One hypothesis is that Ara h 6 was already highly allergenic at the time of the genus divergence from its common ancestors and, thus, one can argue that purifying selection has been operating to maintain the status quo, possibly due to selective advantages for allergenicity. In contrast, Ara h 2 protein at that evolutionary stage displays a lower magnitude of allergenicity and positive selection pressure favors mutations that amplify this trait. The results of our immunoblot experiment provide support for the Ara h 2 case since early emerging species A. trisemenata displayed the lowest IgE-binding ability, 30% of the signal value in the crop A. hypogaea, a terminal species in the phylogenetic tree that accumulated three DPYSPS-containing immunodominant epitopes. Further support also is found in our structural analyses. The three-dimensional structures from homology modeling show the immunodominant epitopes to reside on surface loops, with the size of the loops being related to the degree of allergenicity. Additionally, sequence predictions indicated varying lengths of disordered and protein-binding regions in the sequence range that contains the DPYSPS motif, with species lacking the epitope having fewer residues predicted to be disordered or protein binding. The allergenicity trait has been found to be advantageous as a defense mechanism against insects and pathogens [70, 71]. However, field and laboratory experiments are needed to assess the adaptive advantages of varied magnitudes of allergenicity in Arachis species in their natural habitats.
This work provides insight into the complexity of the evolutionary patterns of allergy-inducing proteins in peanut and promotes similar assessments of the other peanut allergen-inducing homologues. Ara h 2 and Ara h 6 present two distinctive platforms for improving our understanding of peanut allergenicity and its manipulation at the molecular level. The study strongly encourages exploration of the genetic pool for insights into the molecular basis of allergenicity in other allergy-inducing organisms.
Supporting information
S1 Table [pdf]
species used and their respective sectional classification along with information on material sources, open reading frame length in nucleotides, and GenBank accession numbers.S2 Table [pdf]
Amino acid frequencies as percentages of the total for and in the species studied.S3 Table [pdf]
Output from the FUBAR analyses of the and amino acid data sets.S1 Fig [pdf]
Amino acid alignments of and for the species examined in this study deduced from the nucleotide sequence alignment.S2 Fig [pdf]
Amino acid frequencies as percentages of the total deduced amino acid of and in the species examined here.S3 Fig [pdf]
Protein structure overlay and sequence-based epitope and disordered structure predictions for all sequences in this work.
Zdroje
1. Lehrer SB, Ayuso R, Reese G. Current understanding of food allergens. Ann N Y Acad Sci. 2002;964 : 69–85.
2. Grundy J, Matthews S, Bateman B, Dean T, Arshad SH. Rising prevalence of allergy to peanut in children: Data from 2 sequential cohorts. J Allergy Clin Immunol. 2002;110(5):784–9.
3. Sicherer SH, Muñoz-Furlong A, Godbold JH, Sampson HA. US prevalence of self-reported peanut, tree nut, and sesame allergy: 11-year follow-up. Journal of Allergy and Clinical Immunology. 2010;125(6):1322–6.
4. Branum AM, Lukacs SL. Food allergy among U.S. children: trends in prevalence and hospitalizations. NCHS Data Brief. 2008(10):1–8. 19389315
5. Carr WW. Clinical pearls and pitfalls: peanut allergy. Allergy Asthma Proc. 2005;26(2):145–7.
6. Bock SA, Muñoz-Furlong A, Sampson HA. Fatalities due to anaphylactic reactions to foods. J Allergy Clin Immunol. 2001;107(1):191–3.
7. Maleki SJ, Viquez O, Jacks T, Dodo H, Champagne ET, Chung S-Y, et al. The major peanut allergen, Ara h 2, functions as a trypsin inhibitor, and roasting enhances this function. Journal of Allergy and Clinical Immunology. 2003;112(1):190–5.
8. Blumchen K, Ulbricht H, Staden U, Dobberstein K, Beschorner J, de Oliveira LCL, et al. Oral peanut immunotherapy in children with peanut anaphylaxis. J Allergy Clin Immunol. 2010;126(1):83–91.e1.
9. Chen X, Li H, Pandey MK, Yang Q, Wang X, Garg V, et al. Draft genome of the peanut A-genome progenitor (Arachis duranensis) provides insights into geocarpy, oil biosynthesis, and allergens. Proceedings of the National Academy of Sciences. 2016;113(24):6785–90.
10. Shewry PR, Halford NG. Cereal seed storage proteins: structures, properties and role in grain utilization. J Exp Bot. 2002;53(370):947–58. doi: 10.1093/jexbot/53.370.947 11912237
11. Breiteneder H, Radauer C. A classification of plant food allergens☆. Journal of Allergy and Clinical Immunology. 2004;113(5):821–30.
12. Pomés A. Relevant B Cell Epitopes in Allergic Disease. International Archives of Allergy and Immunology. 2010;152(1):1–11.
13. Mueller GA, Maleki SJ, Pedersen LC. The molecular basis of peanut allergy. Curr Allergy Asthma Rep. 2014;14(5):429.
14. Stanley JS, King N, Burks AW, Huang SK, Sampson H, Cockrell G, et al. Identification and Mutational Analysis of the Immunodominant IgE Binding Epitopes of the Major Peanut AllergenAra h 2. Archives of Biochemistry and Biophysics. 1997;342(2):244–53.
15. Barre A, Borges J-P, Culerrier R, Rougé P. Homology modelling of the major peanut allergen Ara h 2 and surface mapping of IgE-binding epitopes. Immunology Letters. 2005;100(2):153–8.
16. Koppelman SJ, Wensing M, Ertmann M, Knulst AC, Knol EF. Relevance of Ara h1, Ara h2 and Ara h3 in peanut-allergic patients, as determined by immunoglobulin E Western blotting, basophil-histamine release and intracutaneous testing: Ara h2 is the most important peanut allergen. Clinical <html_ent glyph = "@amp;" ascii = "&"/> Experimental Allergy. 2004;34(4):583–90.
17. Bernard H, Guillon B, Drumare M-F, Paty E, Dreskin SC, Wal J-M, et al. Allergenicity of peanut component Ara h 2: Contribution of conformational versus linear hydroxyproline-containing epitopes. Journal of Allergy and Clinical Immunology. 2015;135(5):1267–74.e8.
18. Koid AE, Chapman MD, Hamilton RG, van Ree R, Versteeg SA, Dreskin SC, et al. Ara h 6 Complements Ara h 2 as an Important Marker for IgE Reactivity to Peanut. Journal of Agricultural and Food Chemistry. 2014;62(1):206–13.
19. Bernard HM L.; DRUMARE M. F.; PATY E.; SCHEINMANN P., R.; THAÏ AJMW. Identification of a New Natural Ara h 6 Isoform and of Its Proteolytic Product as Major Allergens in. Journal of Agriculture and food Chemistry. 2007;55 : 7.
20. Zhuang Y, Dreskin SC. Redefining the major peanut allergens. Immunologic Research. 2013;55(1–3):125–34.
21. Kulis M, Chen X, Lew J, Wang Q, Patel OP, Zhuang Y, et al. The 2S albumin allergens of Arachis hypogaea, Ara h 2 and Ara h 6, are the major elicitors of anaphylaxis and can effectively desensitize peanut-allergic mice. Clin Exp Allergy. 2012;42(2):326–36. doi: 10.1111/j.1365-2222.2011.03934.x 22288514
22. Blankestijn MA, Otten HG, Suer W, Weimann A, Knol EF, Knulst AC. Specific IgE to peanut 2S albumin Ara h 7 has a discriminative ability comparable to Ara h 2 and 6. Clin Exp Allergy. 2018;48(1):60–5.
23. Kleber-Janke T, Crameri R, Appenzeller U, Schlaak M, Becker W-M. Selective Cloning of Peanut Allergens, Including Profilin and 2S Albumins, by Phage Display Technology. International Archives of Allergy and Immunology. 1999;119(4):265–74.
24. Schmidt HK, Susanne; Gelhaus, Christoph; Petersen, Arnd; Janssen, Ottmar; Becker, Wolf-Meinhard. Detection and Structural Characterization of Natural Ara h 7, the Third Peanut Allergen of the 2S Albumin Family. Journal of Proteome Reserach. 2010;9 : 3701–9.
25. Codreanu F, Collignon O, Roitel O, Thouvenot B, Sauvage C, Vilain AC, et al. A novel immunoassay using recombinant allergens simplifies peanut allergy diagnosis. Int Arch Allergy Immunol. 2011;154(3):216–26.
26. Hilu KW, Stalker HT. Genetic relationships between peanut and wild species ofArachis sect.Arachis (Fabaceae): Evidence from RAPDs. Plant Systematics and Evolution. 1995;198(3):167–78.
27. Kochert G, Stalker HT, Gimenes M, Galgaro L, Lopes CR, Moore K. RFLP and Cytogenetic Evidence on the Origin and Evolution of Allotetraploid Domesticated Peanut, Arachis hypogaea (Leguminosae). American Journal of Botany. 1996;83(10):1282.
28. Chatel J-M, Bernard H, Orson FM. Isolation and Characterization of Two Complete Ara h 2 Isoforms cDNA. International Archives of Allergy and Immunology. 2003;131(1):14–8.
29. Ratnaparkhe MB, Lee T-H, Tan X, Wang X, Li J, Kim C, et al. Comparative and evolutionary analysis of major peanut allergen gene families. Genome Biol Evol. 2014;6(9):2468–88.
30. Ramos ML, Huntley JJ, Maleki SJ, Ozias-Akins P. Identification and characterization of a hypoallergenic ortholog of Ara h 2.01. Plant Molecular Biology. 2009;69(3):325–35.
31. Burks AW, King N, Bannon GA. Modification of a Major Peanut Allergen Leads to Loss of IgE Binding. International Archives of Allergy and Immunology. 1999;118(2–4):313–4. doi: 10.1159/000024114 10224425
32. King N, Helm R, Stanley JS, Vieths S, Lüttkopf D, Hatahet L, et al. Allergenic characteristics of a modified peanut allergen. Molecular Nutrition & Food Research. 2005;49(10):963–71.
33. Friend SA, Quandt D, Tallury SP, Stalker HT, Hilu KW. Species, genomes, and section relationships in the genus Arachis (Fabaceae): a molecular phylogeny. Plant Systematics and Evolution. 2010;290(1–4):185–99.
34. Milla SR, Isleib TG, Stalker HT. Taxonomic relationships among Arachis sect. Arachis species as revealed by AFLP markers. Genome. 2005;48(1):1–11.
35. Voshell SM, Baldini RM, Kumar R, Tatalovich N, Hilu KW. Canary grasses (Phalaris, Poaceae): Molecular phylogenetics, polyploidy and floret evolution. Taxon. 2011;60(5):1306–16.
36. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32(5):1792–7. doi: 10.1093/nar/gkh340 15034147
37. Müller K. QUICKALIGN. 1.03 ed2004.
38. Kelchner SA. The Evolution of Non-Coding Chloroplast DNA and Its Application in Plant Systematics. Annals of the Missouri Botanical Garden. 2000;87(4):482.
39. Maddison DR, Maddison WP. MacClade 4: Analysis of Phylogeny and Character Evolution. 4.08a ed. doi: 10.1093/aob/mci014
40. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis. 6.0 ed. doi: 10.1093/molbev/mst197 24132122
41. Kyte J, Doolittle RF. A simple method for displaying the hydropathic character of a protein. Journal of Molecular Biology. 1982;157(1):105–32.
42. Korber B. Computational and evolutionary analysis of HIV molecular sequences. Boston, MA: Kluwer Academic Publishers; 2001 2001. 300 p.
43. Nei M, Gojobori T. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Molecular Biology and Evolution. 1986;3(5):418–26. doi: 10.1093/oxfordjournals.molbev.a040410 3444411
44. Ota T, Nei M. Variance and covariances of the numbers of synonymous and nonsynonymous substitutions per site. Molecular Biology and Evolution. 1994;11(4):613–9. 8078400
45. Murrell B, Weaver S, Smith MD, Wertheim JO, Murrell S, Aylward A, et al. Gene-wide identification of episodic selection. Mol Biol Evol. 2015;32(5):1365–71. doi: 10.1093/molbev/msv035 25701167
46. Murrell B, Moola S, Mabona A, Weighill T, Sheward D, Kosakovsky Pond SL, et al. FUBAR: a fast, unconstrained bayesian approximation for inferring selection. Mol Biol Evol. 2013;30(5):1196–205. doi: 10.1093/molbev/mst030 23420840
47. Buchan DWA, Minneci F, Nugent TCO, Bryson K, Jones DT. Scalable web services for the PSIPRED Protein Analysis Workbench. Nucleic Acids Research. 2013;41(Web Server issue):W349–57.
48. Power TD, Ivanciuc O, Schein CH, Braun W. Assessment of 3D models for allergen research. Proteins: Structure, Function, and Bioinformatics. 2013;81(4):545–54.
49. Mueller GA, Gosavi RA, Pomés A, Wünschmann S, Moon AF, London RE, et al. Ara h 2: crystal structure and IgE binding distinguish two subpopulations of peanut allergic patients by epitope diversity. Allergy. 2011;66(7):878–85.
50. Molecular Operating Environment. 2015.08 ed. 1010 Sherbooke St. West, Suite #910, Montreal, QC, Canada H3A 2R72017.
51. Case DA, Darden TA, Cheatham TE, Simmerling CL, Wang J, Duke RE, et al. AMBER 12. University of California, San Francisco2012.
52. Wiederstein M, Sippl MJ. ProSA-web: interactive web service for the recognition of errors in three-dimensional structures of proteins. Nucleic Acids Research. 2007;35(Web Server):W407–W10.
53. Lovell SC, Davis IW, Arendall WB, de Bakker PIW, Word JM, Prisant MG, et al. Structure validation by Calpha geometry: phi,psi and Cbeta deviation. Proteins. 2003;50(3):437–50. doi: 10.1002/prot.10286 12557186
54. Melo F, Feytmans E. Assessing protein structures with a non-local atomic interaction energy. Journal of Molecular Biology. 1998;277(5):1141–52.
55. Benkert P, Tosatto SCE, Schomburg D. QMEAN: A comprehensive scoring function for model quality assessment. Proteins. 2008;71(1):261–77.
56. Arnold K, Bordoli L, Kopp J, Schwede T. The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics. 2006;22(2):195–201.
57. Kringelum JV, Lundegaard C, Lund O, Nielsen M. Reliable B Cell Epitope Predictions: Impacts of Method Development and Improved Benchmarking. PLoS Computational Biology. 2012;8(12):e1002829. doi: 10.1371/journal.pcbi.1002829 23300419
58. Andersen PH, Nielsen M, Lund O. Prediction of residues in discontinuous B-cell epitopes using protein 3D structures. Protein Science. 2006;15(11):2558–67. doi: 10.1110/ps.062405906 17001032
59. Ponomarenko J, Bui H-H, Li W, Fusseder N, Bourne PE, Sette A, et al. ElliPro: a new structure-based tool for the prediction of antibody epitopes. BMC Bioinformatics. 2008;9(1):514.
60. Nishikawa K, Ooi T. Prediction of the surface-interior diagram of globular proteins by an empirical method. Int J Pept Protein Res. 1980;16(1):19–32.
61. Prescott SL, Taylor A, King B, Dunstan J, Upham JW, Thornton CA, et al. Neonatal interleukin-12 capacity is associated with variations in allergen-specific immune responses in the neonatal and postnatal periods. Clin Exp Allergy. 2003;33(5):566–72. doi: 10.1046/j.1365-2222.2003.01659.x 12752583
62. DeRose-Wilson LJ, Gaut BS. Transcription-related mutations and GC content drive variation in nucleotide substitution rates across the genomes of Arabidopsis thaliana and Arabidopsis lyrata. BMC Evolutionary Biology. 2007;7(1):66.
63. Dillon MM, Sung W, Sebra R, Lynch M, Cooper VS. Genome-Wide Biases in the Rate and Molecular Spectrum of Spontaneous Mutations in Vibrio cholerae and Vibrio fischeri. Molecular Biology and Evolution. 2017;34(1):93–109.
64. Li W, Graur D. Fundamentals of molecular evolution. Sunderland, MA: Sinauer Associates; 1991. p. 15.
65. Latif S, Pfannstiel J, Makkar HP, Becker K. Amino acid composition, antinutrients and allergens in the peanut protein fraction obtained by an aqueous enzymatic process. Food Chem. 2013;136(1):213–7. doi: 10.1016/j.foodchem.2012.07.120 23017415
66. Lehmann K, Schweimer K, Reese G, Randow S, Suhr M, Becker W-M, et al. Structure and stability of 2S albumin-type peanut allergens: implications for the severity of peanut allergic reactions. Biochemical Journal. 2006;395(3):463–72.
67. Ramos ML, Fleming G, Chu Y, Akiyama Y, Gallo M, Ozias-Akins P. Chromosomal and phylogenetic context for conglutin genes in Arachis based on genomic sequence. Mol Genet Genomics. 2006;275(6):578–92. doi: 10.1007/s00438-006-0114-z 16614814
68. Guindon S, Rodrigo AG, Dyer KA, Huelsenbeck JP. Modeling the site-specific variation of selection patterns along lineages. Proc Natl Acad Sci U S A. 2004;101(35):12957–62.
69. Lu A, Guindon S. Performance of standard and stochastic branch-site models for detecting positive selection among coding sequences. Mol Biol Evol. 2014;31(2):484–95.
70. Martins PL, Roseane CdS, Joo LdSF, Fbia SLP, Liziane MdL. Trypsin (serine protease) inhibitors in peanut genotypes aiming for control of stored grain pests. African Journal of Agricultural Research. 2014;9(30):2362–8.
71. Terras FRG, Eggermont K, Kovaleva V, Raikhel NV, Osborn RW, Kester A, et al. Small Cysteine-Rich Antifungal Proteins from Radish: Their Role in Host Defense. The Plant Cell. 1995;7(5):573.
72. Agizzio AP, Da Cunha M, Carvalho AO, Oliveira MA, Ribeiro SFF, Gomes VM. The antifungal properties of a 2S albumin-homologous protein from passion fruit seeds involve plasma membrane permeabilization and ultrastructural alterations in yeast cells. Plant Sci. 2006;171(4):515–22. doi: 10.1016/j.plantsci.2006.06.001 25193649
73. MacRaild CA, Zachrdla M, Andrew D, Krishnarjuna B, Novacek J, Zidek L, et al. Conformational dynamics and antigenicity in the disordered malaria antigen merozoite surface protein 2. PLoS One. 2015;10(3):e0119899. doi: 10.1371/journal.pone.0119899 25742002
74. Rubinstein ND, Mayrose I, Halperin D, Yekutieli D, Gershoni JM, Pupko T. Computational characterization of B-cell epitopes. Mol Immunol. 2008;45(12):3477–89. doi: 10.1016/j.molimm.2007.10.016 18023478
75. Otsu K, Guo R, Dreskin SC. Epitope analysis of Ara h 2 and Ara h 6: characteristic patterns of IgE-binding fingerprints among individuals with similar clinical histories. Clinical & Experimental Allergy. 2015;45(2):471–84.
Článek A study of psychological pain in substance use disorder and its relationship to treatment outcomeČlánek Addiction of mesenchymal phenotypes on the FGF/FGFR axis in oral squamous cell carcinoma cellsČlánek A digital collection of rare and endangered lemurs and other primates from the Duke Lemur CenterČlánek Protocol development for discovery of angiogenesis inhibitors via automated methods using zebrafishČlánek Temporal weights in loudness: Investigation of the effects of background noise and sound levelČlánek Isolation and identification of an isoflavone reducing bacterium from feces from a pregnant horseČlánek The bacterial community in potato is recruited from soil and partly inherited across generationsČlánek Infective endocarditis and diabetes mellitus: Results from a single-center study from 1994 to 2017Článek The trajectory of patterns of light and sedentary physical activity among females, ages 14-23Článek Estimation of maize evapotraspiration under drought stress - A case study of Huaibei Plain, ChinaČlánek Honey bee microbiome associated with different hive and sample types over a honey production seasonČlánek Incidence of colorectal cancer in Eritrea: Data from the National Health Laboratory, 2011-2017Článek Dispersion of Legionella bacteria in atmosphere: A practical source location estimation methodČlánek Factors influencing bird-building collisions in the downtown area of a major North American cityČlánek Decreased retinal thickness in patients with Alzheimer’s disease is correlated with disease severityČlánek Moving system with action sport cameras: 3D kinematics of the walking and running in a large volumeČlánek High heat tolerance in plants from the Andean highlands: Implications for paramos in a warmer worldČlánek Impacts of risk and competition on the profitability of banks: Empirical evidence from PakistanČlánek Tributyltin chloride (TBT) induces RXRA down-regulation and lipid accumulation in human liver cellsČlánek Differences in clinical features of cluster headache between drinkers and nondrinkers in JapanČlánek Polo-like kinase 1 (Plk1) inhibition synergizes with taxanes in triple negative breast cancerČlánek Genome-wide SNP analyses reveal population structure of Portunus pelagicus along Vietnam coastlineČlánek Manipulating the odds: The effects of Machiavellianism and construal level on cheating behaviorČlánek Primary care in five European countries: A citizens’ perspective on the quality of care for childrenČlánek Overcoming platinum resistance in ovarian cancer by targeting pregnancy-associated plasma protein-AČlánek Capacity of the medullary cavity of tibia and femur for intra-bone marrow transplantation in miceČlánek Phylogenetic revision of Gymnotidae (Teleostei: Gymnotiformes), with descriptions of six subgeneraČlánek Hidden noise in immunologic parameters might explain rapid progression in early-onset periodontitisČlánek Identification of a novel monocytic phenotype in Classic Hodgkin Lymphoma tumor microenvironmentČlánek Binding and dynamics of melatonin at the interface of phosphatidylcholine-cholesterol membranesČlánek Retinoic acid-stimulated ERK1/2 pathway regulates meiotic initiation in cultured fetal germ cellsČlánek Gender disparities in scientific production: A nationwide assessment among physicians in PeruČlánek Study on the damage characteristics of gas-bearing shale under different unloading stress pathsČlánek Association of clinical factors with survival outcomes in laryngeal squamous cell carcinoma (LSCC)Článek Population preferences for breast cancer screening policies: Discrete choice experiment in BelarusČlánek Appropriate management of acute gastroenteritis in Australian children: A population-based studyČlánek More than just availability: Who has access and who administers take-home naloxone in Baltimore, MDČlánek Protein synthesis rates of muscle, tendon, ligament, cartilage, and bone tissue in vivo in humansČlánek Molecular characterisation of genital human papillomavirus among women in Southwestern, NigeriaČlánek Gene expression microarray public dataset reanalysis in chronic obstructive pulmonary diseaseČlánek Utility of the new cobas HCV test for viral load monitoring during direct-acting antiviral therapyČlánek Whole body periodic acceleration in normal and reduced mucociliary clearance of conscious sheepČlánek Minimal effects of oyster aquaculture on local water quality: Examples from southern Chesapeake BayČlánek Finding phrases: On the role of co-verbal facial information in learning word order in infancyČlánek Yeasts affect tolerance of Drosophila melanogaster to food substrate with high NaCl concentrationČlánek The effect of climate change on cholera disease: The road ahead using artificial neural networkČlánek Adaptive fuzzy flow rate control considering multifractal traffic modeling and 5G communicationsČlánek UM171 induces a homeostatic inflammatory-detoxification response supporting human HSC self-renewalČlánek The ZJU index is a powerful surrogate marker for NAFLD in severely obese North American womenČlánek Vaccine cold chain in general practices: A prospective study in 75 refrigerators (Keep Cool study)Článek Artificial insemination with fresh, liquid stored and frozen thawed semen in dromedary camelsČlánek Mammary microbiome of lactating organic dairy cows varies by time, tissue site, and infection statusČlánek An outbreak of tuberculosis in a middle school in Henan, China: Epidemiology and risk factorsČlánek Impact of UVC-sustained recirculating air filtration on airborne bacteria and dust in a pig facilityČlánek Pre-clinical medical student reflections on implicit bias: Implications for learning and teachingČlánek Foxtail millet (Setaria italica (L.) P. Beauv) CIPKs are responsive to ABA and abiotic stressesČlánek Calreticulin regulates vascular endothelial growth factor-A mRNA stability in gastric cancer cellsČlánek The association between haemoglobin levels in the first 20 weeks of pregnancy and pregnancy outcomesČlánek Factors associated with persistently high-cost health care utilization for musculoskeletal painČlánek Why men with a low-risk prostate cancer select and stay on active surveillance: A qualitative studyČlánek Imported severe malaria and risk factors for intensive care: A single-centre retrospective analysisČlánek Effectiveness of telerehabilitation in the management of adults with stroke: A systematic reviewČlánek Evaluation of neutral oral contrast agents for assessment of the small bowel at abdominal staging CTČlánek Determinants of mortality among patients with drug-resistant tuberculosis in northern NigeriaČlánek Effects of tetracycline on myocardial infarct size in obese rats with chemically-induced colitisČlánek Patient-level cost of home- and facility-based child pneumonia treatment in Suba Sub County, KenyaČlánek TAP: A static analysis model for PHP vulnerabilities based on token and deep learning technologyČlánek Time trends between 2002 and 2017 in correlates of self-reported sitting time in European adultsČlánek Establishment of the experimental procedure for prediction of conjugation capacity in mutant UGT1A1Článek The performance of practitioners conducting facial comparisons on images of children across ageČlánek Risk of temperature, humidity and concentrations of air pollutants on the hospitalization of AECOPDČlánek Willingness to receive institutional and community-based eldercare among the rural elderly in ChinaČlánek Nonarteritic anterior ischemic optic neuropathy is associated with cerebral small vessel diseaseČlánek An evolution of socioeconomic related inequality in teenage pregnancy and childbearing in MalawiČlánek Migration and political polarization in the U.S.: An analysis of the county-level migration networkČlánek Retraction: Placental expression of CD100, CD72 and CD45 is dysregulated in human miscarriageČlánek Oxygen delivery, oxygen consumption and decreased kidney function after cardiopulmonary bypassČlánek Location, location, location: Close ties among older continuing care retirement community residentsČlánek Metabolic costs of spontaneous swimming in Sprattus sprattus L., at different water temperaturesČlánek Multiple innate antibacterial immune defense elements are correlated in diverse ungulate speciesČlánek First evidence of hepatitis E virus infection in a small mammal (yellow-necked mouse) from CroatiaČlánek Semantic computational analysis of anticoagulation use in atrial fibrillation from real world dataČlánek A mathematical model of honey bee colony dynamics to predict the effect of pollen on colony failureČlánek Socioeconomic determinants of cancer screening utilisation in Latin America: A systematic reviewČlánek Towards successful business process improvement – An extension of change acceleration process modelČlánek Correction: Intensive longitudinal modelling predicts diurnal activity of salivary alpha-amylaseČlánek HHIP overexpression inhibits the proliferation, migration and invasion of non-small cell lung cancerČlánek Influence of season and social context on male giant panda (Ailuropoda melanoleuca) vocal behaviourČlánek Development of an intravaginal ring for the topical delivery of Aurora kinase A inhibitor, MLN8237
Článok vyšiel v časopisePLOS One
Najčítanejšie tento týždeň
2019 Číslo 11- Metamizol jako analgetikum první volby: kdy, pro koho, jak a proč?
- Masturbační chování žen v ČR − dotazníková studie
- Nejasný stín na plicích – kazuistika
- Postup rychlého zotavení po operaci zlomeniny krčku femuru
- Profylaxe infekční endokarditidy ve stomatologii
-
Všetky články tohto čísla
- Wild Steps in a semi-wild setting? Habitat selection and behavior of European bison reintroduced to an enclosure in an anthropogenic landscape
- The effect of facial expression on contrast sensitivity: A behavioural investigation and extension of Hedger, Adams & Garner (2015)
- Non-communicable diseases risk factors and their determinants: A cross-sectional state-wide STEPS survey, Haryana, North India
- Genotype-matched Newcastle disease virus vaccine confers improved protection against genotype XII challenge: The importance of cytoplasmic tails in viral replication and vaccine design
- Combined transcriptomics and proteomics forecast analysis for potential genes regulating the Columbian plumage color in chickens
- Persistence of traditional and emergence of new structural drivers and factors for the HIV epidemic in rural Uganda; A qualitative study
- Competency assessment of the medical interns and nurses and documenting prevailing practices to provide family planning services in teaching hospitals in three states of India
- Choice of birth place among antenatal clinic attendees in rural mission hospitals in Ebonyi State, South-East Nigeria
- Dual pathway for metabolic engineering of Escherichia coli to produce the highly valuable hydroxytyrosol
- Genetic and genomic analyses underpin the feasibility of concomitant genetic improvement of milk yield and mastitis resistance in dairy sheep
- Long-term exposure to daily ethanol injections in DBA/2J and Swiss mice: Lessons for the interpretation of ethanol sensitization
- Taxonomic and functional anuran beta diversity of a subtropical metacommunity respond differentially to environmental and spatial predictors
- A simple way to improve a conventional A/O-MBR for high simultaneous carbon and nutrient removal from synthetic municipal wastewater
- Knowledge and awareness of cervical cancer in Southwestern Ethiopia is lacking: A descriptive analysis
- Flat electrode contacts for vagus nerve stimulation
- Circulating Th17.1 cells as candidate for the prediction of therapeutic response to abatacept in patients with rheumatoid arthritis: An exploratory research
- Prevalence and socioeconomic determinants of development delay among children in Ceará, Brazil: A population-based study
- Characterizing macroinvertebrate community composition and abundance in freshwater tidal wetlands of the Sacramento-San Joaquin Delta
- A randomized controlled trial comparing isosorbide dinitrate-oxytocin versus misoprostol-oxytocin at management of foetal intrauterine death
- Hello, is that me you are looking for? A re-examination of the role of the DMN in social and self relevant aspects of off-task thought
- Lactobacillus rhamnosus Lcr35 as an effective treatment for preventing Candida albicans infection in the invertebrate model Caenorhabditis elegans: First mechanistic insights
- Use of latent class analysis to identify multimorbidity patterns and associated factors in Korean adults aged 50 years and older
- A study of psychological pain in substance use disorder and its relationship to treatment outcome
- Effects of artificially introduced Enterococcus faecalis strains in experimental necrotizing enterocolitis
- Treatment-seeking for vaginal fistula in sub-Saharan Africa
- Dissemination and stakeholder engagement practices among dissemination & implementation scientists: Results from an online survey
- Comparative analysis of the accelerated aged seed transcriptome profiles of two maize chromosome segment substitution lines
- Transactional sex among men who have sex with men participating in the CohMSM prospective cohort study in West Africa
- Addiction of mesenchymal phenotypes on the FGF/FGFR axis in oral squamous cell carcinoma cells
- Left parietal tACS at alpha frequency induces a shift of visuospatial attention
- Microtranscriptome analysis of sugarcane cultivars in response to aluminum stress
- The role of alien species on plant-floral visitor network structure in invaded communities
- Predictive factors for unfavourable treatment in MDR-TB and XDR-TB patients in Rio de Janeiro State, Brazil, 2000-2016
- Agricultural impacts on streams near Nitrate Vulnerable Zones: A case study in the Ebro basin, Northern Spain
- Development of a multi-locus typing scheme for an Enterobacteriaceae linear plasmid that mediates inter-species transfer of flagella
- The roles of MRI-based prostate volume and associated zone-adjusted prostate-specific antigen concentrations in predicting prostate cancer and high-risk prostate cancer
- Re-modeling of foliar membrane lipids in a seagrass allows for growth in phosphorus-deplete conditions
- Effect of sampling frequency on fractal fluctuations during treadmill walking
- Effect of calcium intake and the dietary cation-anion difference during early lactation on the bone mobilization dynamics throughout lactation in dairy cows
- Facilitators and barriers to linkage to HIV care and treatment among female sex workers in a community-based HIV prevention intervention in Tanzania: A qualitative study
- Tuberculosis treatment outcome: The case of women in Ethiopia and China, ten-years retrospective cohort study
- Protein:Protein interactions in the cytoplasmic membrane apparently influencing sugar transport and phosphorylation activities of the e. coli phosphotransferase system
- A digital collection of rare and endangered lemurs and other primates from the Duke Lemur Center
- Computational fluid dynamics simulation of changes in the morphology and airflow dynamics of the upper airways in OSAHS patients after treatment with oral appliances
- Resistome metagenomics from plate to farm: The resistome and microbial composition during food waste feeding and composting on a Vermont poultry farm
- Lower limb chronic edema management program: Perspectives of disengaged patients on challenges, enablers and barriers to program attendance and adherence
- Discovery of powdery mildew resistance gene candidates from Aegilops biuncialis chromosome 2Mb based on transcriptome sequencing
- Modelling vegetation understory cover using LiDAR metrics
- Assessing the impact of the “one-child policy” in China: A synthetic control approach
- CRISPR-Cas9 modified bacteriophage for treatment of Staphylococcus aureus induced osteomyelitis and soft tissue infection
- Forecasting type-specific seasonal influenza after 26 weeks in the United States using influenza activities in other countries
- Chronic exercise modulates the cellular immunity and its cannabinoid receptors expression
- Characterization of the diverse plasmid pool harbored by the blaNDM-1-containing Acinetobacter bereziniae HPC229 clinical strain
- What does mitogenomics tell us about the evolutionary history of the Drosophila buzzatii cluster (repleta group)?
- A cell-based evaluation of a non-essential amino acid formulation as a non-bioactive control for activation and stimulation of muscle protein synthesis using ex vivo human serum
- Conjugated linoleic acid as a novel insecticide targeting the agricultural pest Leptinotarsa decemlineata
- Relationship between pattern electroretinogram and optic disc morphology in glaucoma
- Depicting changes in land surface cover at Al-Hassa oasis of Saudi Arabia using remote sensing and GIS techniques
- Land snail dispersal, abundance and diversity on green roofs
- Fanconi-BRCA pathway mutations in childhood T-cell acute lymphoblastic leukemia
- Mesenchymal Stem/ Stromal Cells metabolomic and bioactive factors profiles: A comparative analysis on the umbilical cord and dental pulp derived Stem/ Stromal Cells secretome
- The association between caesarean section delivery and later life obesity in 21-24 year olds in an Urban South African birth cohort
- Diagnosis and treatment of acute respiratory illness in children under five in primary care in low-, middle-, and high-income countries: A descriptive FRESH AIR study
- Quality control of cervical cytology using a 3-type HPV mRNA test increases screening program sensitivity of cervical intraepithelial neoplasia grade 2+ in young Norwegian women—A cohort study
- Toxicity and sublethal effects of two plant allelochemicals on the demographical traits of cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae)
- Protocol development for discovery of angiogenesis inhibitors via automated methods using zebrafish
- Friends with malefit. The effects of keeping dogs and cats, sustaining animal-related injuries and Toxoplasma infection on health and quality of life
- Trueness of digital intraoral impression in reproducing multiple implant position
- Comparison of drug safety data obtained from the monitoring system, literature, and social media: An empirical proof from a Chinese patent medicine
- Norm values and psychometric properties of the short version of the Trier Inventory for Chronic Stress (TICS) in a representative German sample
- Maternal health and birth outcomes in a South African birth cohort study
- Structural characterization of scorpion peptides and their bactericidal activity against clinical isolates of multidrug-resistant bacteria
- Molecular evolution of genes encoding allergen proteins in the peanuts genus Arachis: Structural and functional implications
- Structural characterization of the saxitoxin-targeting APTSTX1 aptamer using optical tweezers and molecular dynamics simulations
- Residential household yard care practices along urban-exurban gradients in six climatically-diverse U.S. metropolitan areas
- Formal comment on “Assessing the impact of the ‘one-child policy’ in China: A synthetic control approach”
- Evaluation of a global spring wheat panel for stripe rust: Resistance loci validation and novel resources identification
- “Big men” in the office: The gender-specific influence of weight upon persuasiveness
- Modification of everyday activities and its association with self-awareness in cognitively diverse older adults
- The effect of bivalve filtration on eDNA-based detection of aquatic organisms
- Selective culture enrichment and sequencing of feces to enhance detection of antimicrobial resistance genes in third-generation cephalosporin resistant Enterobacteriaceae
- Development and validation of rapid environmental DNA (eDNA) detection methods for bog turtle (Glyptemys muhlenbergii)
- Average and time-specific maternal prenatal inflammatory biomarkers and the risk of labor epidural associated fever
- Preference-based measure of health-related quality of life and its determinants in sickle cell disease in Nigeria
- Factors influencing participation dynamics in research for development interventions with multi-stakeholder platforms: A metric approach to studying stakeholder participation
- Contextual variation in young children’s acquisition of social-emotional skills
- Prokaryotic and eukaryotic microbiomes associated with blooms of the ichthyotoxic dinoflagellate Cochlodinium (Margalefidinium) polykrikoides in New York, USA, estuaries
- Reconciling the statistics of spectral reflectance and colour
- Temporal weights in loudness: Investigation of the effects of background noise and sound level
- A global assessment of street-network sprawl
- Correction: KRIT1 Regulates the Homeostasis of Intracellular Reactive Oxygen Species
- Mindfulness-Based Blood Pressure Reduction (MB-BP): Stage 1 single-arm clinical trial
- Measurement of abortion safety using community-based surveys: Findings from three countries
- Behavioral response of naïve and non-naïve deer to wolf urine
- SNARE proteins rescue impaired autophagic flux in Down syndrome
- Negative impact of gestational diabetes mellitus on progress of pelvic floor muscle electromyography activity: Cohort study
- Change in left inferior frontal connectivity with less unexpected harmonic cadence by musical expertise
- Structural mechanism for regulation of DNA binding of BpsR, a Bordetella regulator of biofilm formation, by 6-hydroxynicotinic acid
- How does open innovation lead competitive advantage? A dynamic capability view perspective
- Bull efficiency using dairy genetic traits
- Improved cortical boundary registration for locally distorted fMRI scans
- Extractive single document summarization using binary differential evolution: Optimization of different sentence quality measures
- Measuring the tilt and slant of Chinese handwriting in primary school students: A computerized approach
- Isolation and identification of an isoflavone reducing bacterium from feces from a pregnant horse
- Sugar labeling: How numerical information of sugar content influences healthiness and tastiness expectations
- Optimally adjusted last cluster for prediction based on balancing the bias and variance by bootstrapping
- Quantifying normal and parkinsonian gait features from home movies: Practical application of a deep learning–based 2D pose estimator
- Heterogeneity of porcine bone marrow-derived dendritic cells induced by GM-CSF
- Can visual interpretation of NucliSens graphs reduce the need for repeat viral load testing?
- Manganese levels in infant formula and young child nutritional beverages in the United States and France: Comparison to breast milk and regulations
- Association between metabolic body composition status and risk for impaired renal function: A cross-sectional study
- Toddler skills predict moderate-to-late preterm born children’s cognition and behaviour at 6 years of age
- The bacterial community in potato is recruited from soil and partly inherited across generations
- Infective endocarditis and diabetes mellitus: Results from a single-center study from 1994 to 2017
- Patient satisfaction with HIV services in Vietnam: Status, service models and association with treatment outcome
- Ion concentration polarization (ICP) of proteins at silicon micropillar nanogaps
- The trajectory of patterns of light and sedentary physical activity among females, ages 14-23
- Coadministration of kla peptide with HPRP-A1 to enhance anticancer activity
- Measuring the complexity of directed graphs: A polynomial-based approach
- Estimation of maize evapotraspiration under drought stress - A case study of Huaibei Plain, China
- Publication rates in animal research. Extent and characteristics of published and non-published animal studies followed up at two German university medical centres
- Developmental conservation of microRNA gene localization at the nuclear periphery
- Exploring critical factors of the perceived usefulness of blended learning for higher education students
- Anti-Alzheimer potential, metabolomic profiling and molecular docking of green synthesized silver nanoparticles of Lampranthus coccineus and Malephora lutea aqueous extracts
- Protective effect of Platymiscium floribundum Vog. in tree extract on periodontitis inflammation in rats
- Direct transport vs secondary transfer to level I trauma centers in a French exclusive trauma system: Impact on mortality and determinants of triage on road-traffic victims
- Honey bee microbiome associated with different hive and sample types over a honey production season
- Bacterial communities in the rhizosphere, phyllosphere and endosphere of tomato plants
- Sildenafil citrate long-term treatment effects on cardiovascular reactivity in a SHR experimental model of metabolic syndrome
- Postoperative delirium after lung resection for primary lung cancer: Risk factors, risk scoring system, and prognosis
- The CSF-1-receptor inhibitor, JNJ-40346527 (PRV-6527), reduced inflammatory macrophage recruitment to the intestinal mucosa and suppressed murine T cell mediated colitis
- Using Er:YAG laser to remove lithium disilicate crowns from zirconia implant abutments: An in vitro study
- Antibacterial efficacy of cold atmospheric plasma against Enterococcus faecalis planktonic cultures and biofilms in vitro
- Mechanisms of African swine fever virus pathogenesis and immune evasion inferred from gene expression changes in infected swine macrophages
- Application of ensemble methods to analyse the decline of organochlorine pesticides in relation to the interactions between age, gender and time
- Mitogenomic diversity in Sacred Ibis Mummies sheds light on early Egyptian practices
- Automated detection of a nonperfusion area caused by retinal vein occlusion in optical coherence tomography angiography images using deep learning
- Characterisation of a novel SCCmec VI element harbouring fusC in an emerging Staphylococcus aureus strain from the Arabian Gulf region
- Inducible UCP1 silencing: A lentiviral RNA-interference approach to quantify the contribution of beige fat to energy homeostasis
- iCrotoK-PseAAC: Identify lysine crotonylation sites by blending position relative statistical features according to the Chou’s 5-step rule
- Emerging practices supporting diabetes self-management among food insecure adults and families: A scoping review
- Does aneurysm side influence the infarction side and patients´ outcome after subarachnoid hemorrhage?
- Raising the bar: Recovery ambition for species at risk in Canada and the US
- Management of locally advanced non-small cell lung cancer in the modern era: A national Italian survey on diagnosis, treatment and multidisciplinary approach
- Foraging strategies are maintained despite workforce reduction: A multidisciplinary survey on the pollen collected by a social pollinator
- Incidence of colorectal cancer in Eritrea: Data from the National Health Laboratory, 2011-2017
- Integrated analysis of miRNA landscape and cellular networking pathways in stage-specific prostate cancer
- Evaluation of the reactogenicity, adjuvanticity and antigenicity of LT(R192G) and LT(R192G/L211A) by intradermal immunization in mice
- Role of rhesus macaque IFITM3(2) in simian immunodeficiency virus infection of macaques
- Variation in the LRR region of Pi54 protein alters its interaction with the AvrPi54 protein revealed by in silico analysis
- Evolutionarily conserved susceptibility of the mitochondrial respiratory chain to SDHI pesticides and its consequence on the impact of SDHIs on human cultured cells
- Statistical determination of synergy based on Bliss definition of drugs independence
- The association between sleep problems and academic performance in primary school-aged children: Findings from a Norwegian longitudinal population-based study
- Estimating the national cost burden of in-hospital needlestick injuries among healthcare workers in Japan
- Assessing reliability of intra-tumor heterogeneity estimates from single sample whole exome sequencing data
- Dispersion of Legionella bacteria in atmosphere: A practical source location estimation method
- Integrative proteomic and phosphoproteomic profiling of prostate cell lines
- Treatment paths for localised prostate cancer in Italy: The results of a multidisciplinary, observational, prospective study (Pros-IT CNR)
- Why are undergraduate emerging adults anxious and avoidant in their romantic relationships? The role of family relationships
- Barriers to implementation of emergency obstetric and neonatal care in rural Pakistan
- Testosterone supplementation improves insulin responsiveness in HFD fed male T2DM mice and potentiates insulin signaling in the skeletal muscle and C2C12 myocyte cell line
- Ang-(1-7)/ MAS1 receptor axis inhibits allergic airway inflammation via blockade of Src-mediated EGFR transactivation in a murine model of asthma
- Factors influencing bird-building collisions in the downtown area of a major North American city
- Collembola laterally move biochar particles
- Decreased retinal thickness in patients with Alzheimer’s disease is correlated with disease severity
- Moving system with action sport cameras: 3D kinematics of the walking and running in a large volume
- Factors influencing subclinical atherosclerosis in patients with biopsy-proven nonalcoholic fatty liver disease
- Boundary violations and adolescent drinking: Observational evidence that symbolic boundaries moderate social influence
- Inadequate conflict of interest policies at most French teaching hospitals: A survey and website analysis
- A new resolution function to evaluate tree shape statistics
- Thermostat wars? The roles of gender and thermal comfort negotiations in household energy use behavior
- Patients undergoing surgery for lumbar spinal stenosis experience unique courses of pain and disability: A group-based trajectory analysis
- Lifetime prevalence of intimate partner violence against women in an urban Brazilian city: A cross-sectional survey
- The factors associated with being left-behind children in China: Multilevel analysis with nationally representative data
- High heat tolerance in plants from the Andean highlands: Implications for paramos in a warmer world
- Quantifying pediatric patient need for second- and third-line HIV treatment: A tool for decision-making in resource-limited settings
- Discovery of actionable genetic alterations with targeted panel sequencing in children with relapsed or refractory solid tumors
- Iodine status of non-pregnant women and availability of food vehicles for fortification with iodine in a remote community in Gulf province, Papua New Guinea
- Fibre and extracellular matrix contributions to passive forces in human skeletal muscles: An experimental based constitutive law for numerical modelling of the passive element in the classical Hill-type three element model
- The status of imported Barremian-Bedoulian flint in north-eastern Iberia during the Middle Neolithic. Insights from the variscite mines of Gavà (Barcelona)
- Psychology of personal data donation
- Radiocarbon dating and cultural dynamics across Mongolia’s early pastoral transition
- MARGO (Massively Automated Real-time GUI for Object-tracking), a platform for high-throughput ethology
- Visual detection of time-varying signals: Opposing biases and their timescales
- Results from a World Health Organization pilot of the Basic Emergency Care Course in Sub Saharan Africa
- Scientists’ opinions and attitudes towards citizens’ understanding of science and their role in public engagement activities
- Dacentrurine stegosaurs (Dinosauria): A new specimen of Miragaia longicollum from the Late Jurassic of Portugal resolves taxonomical validity and shows the occurrence of the clade in North America
- Integrated pan-cancer gene expression and drug sensitivity analysis reveals SLFN11 mRNA as a solid tumor biomarker predictive of sensitivity to DNA-damaging chemotherapy
- Does membrane feeding compromise the quality of Aedes aegypti mosquitoes?
- Morphology, phylogeny, and taxonomy of two species of colonial volvocine green algae from Lake Victoria, Tanzania
- Metabolomics profiles associated with HbA1c levels in patients with type 2 diabetes
- Exploring local realities: Perceptions and experiences of healthcare workers on the management and control of drug-resistant tuberculosis in Addis Ababa, Ethiopia
- Sex differences in the treatment and outcome of emergency general surgery
- Comorbidities and costs in HIV patients: A retrospective claims database analysis in Germany
- Barriers to integration of bioinformatics into undergraduate life sciences education: A national study of US life sciences faculty uncover significant barriers to integrating bioinformatics into undergraduate instruction
- Local unemployment changes the springboard effect of low pay: Evidence from England
- A comparison of body composition assessment methods in climbers: Which is better?
- Comparison of an in-house ‘home-brew’ and commercial ViroSeq integrase genotyping assays on HIV-1 subtype C samples
- Elucidating genetic variability and population structure in Venturia inaequalis associated with apple scab diseaseusing SSR markers
- Clustering via hypergraph modularity
- Indomethacin enhances anti-tumor efficacy of a MUC1 peptide vaccine against breast cancer in MUC1 transgenic mice
- Multistage fuzzy comprehensive evaluation of landslide hazards based on a cloud model
- Inducible microRNA-200c decreases motility of breast cancer cells and reduces filamin A
- Pharmacological signatures of the reduced incidence and the progression of cognitive decline in ageing populations suggest the protective role of beneficial polypharmacy
- Continuous influenza virus production in a tubular bioreactor system provides stable titers and avoids the “von Magnus effect”
- Complex interaction networks of cytokines after transarterial chemotherapy in patients with hepatocellular carcinoma
- Gender essentialism in transgender and cisgender children
- Insertional mutagenesis in the zoonotic pathogen Chlamydia caviae
- Being there: A scoping review of grief support training in medical education
- Does the psychological profile influence the position of promising young futsal players?
- Effect of self-rated health status on functioning difficulties among older adults in Ghana: Coarsened exact matching method of analysis of the World Health Organization’s study on global AGEing and adult health, Wave 2
- Olfactory screening of Parkinson’s Disease patients and healthy subjects in China and Germany: A study of cross-cultural adaptation of the Sniffin’ Sticks 12-identification test
- Molecular evolution of cytochrome C oxidase-I protein of insects living in Saudi Arabia
- Correlates of leisure-time sedentary behavior among 181,793 adolescents aged 12-15 years from 66 low- and middle-income countries
- Cost-effectiveness analysis of Mucosal Leishmaniasis diagnosis with PCR-based vs parasitological tests in Colombia
- Spatiotemporal analysis of historical records (2001–2012) on dengue fever in Vietnam and development of a statistical model for forecasting risk
- Resilience assessment of Puerto Rico’s coral reefs to inform reef management
- Effect of community based health education on knowledge and attitude towards iron and folic acid supplementation among pregnant women in Kiambu County, Kenya: A quasi experimental study
- Implementation and effectiveness of non-specialist mediated interventions for children with Autism Spectrum Disorder: A systematic review and meta-analysis
- A tailored cognitive behavioral program for juvenile justice-referred females at risk of substance use and delinquency: A pilot quasi-experimental trial
- Impact of adjusted kidney volume measured in the bench surgery on one-year renal function in kidney transplantation
- Machine learning algorithm validation with a limited sample size
- The magnitude of suicidal ideation, attempts and associated factors of HIV positive youth attending ART follow ups at St. Paul’s hospital Millennium Medical College and St. Peter’s specialized hospital, Addis Ababa, Ethiopia, 2018
- The nonlinear effect of financial and fiscal policies on poverty alleviation in China—An empirical analysis of Chinese 382 impoverished counties with PSTR models
- Impacts of risk and competition on the profitability of banks: Empirical evidence from Pakistan
- Molecular characterization of lung adenocarcinoma from Korean patients using next generation sequencing
- An expansin-like protein expands forage cell walls and synergistically increases hydrolysis, digestibility and fermentation of livestock feeds by fibrolytic enzymes
- Joint image compression and encryption based on sparse Bayesian learning and bit-level 3D Arnold cat maps
- Urticating setae of tarantulas (Araneae: Theraphosidae): Morphology, revision of typology and terminology and implications for taxonomy
- Live observation of the oviposition process in Daphnia magna
- On the accuracy of displacement-based wave intensity analysis: Effect of vessel wall viscoelasticity and nonlinearity
- Nodosilinea signiensis sp. nov. (Leptolyngbyaceae, Synechococcales), a new terrestrial cyanobacterium isolated from mats collected on Signy Island, South Orkney Islands, Antarctica
- A 3’ UTR SNP rs885863, a cis-eQTL for the circadian gene VIPR2 and lincRNA 689, is associated with opioid addiction
- Characterizing the Randot Preschool stereotest: Testability, norms, reliability, specificity and sensitivity in children aged 2-11 years
- Tributyltin chloride (TBT) induces RXRA down-regulation and lipid accumulation in human liver cells
- Amazon climatic factors driving terpene composition of Iryanthera polyneura Ducke in terra-firme forest: A statistical approach
- Differences in clinical features of cluster headache between drinkers and nondrinkers in Japan
- Distribution of macular ganglion cell layer thickness in foveal hypoplasia: A new diagnostic criterion for ocular albinism
- Polo-like kinase 1 (Plk1) inhibition synergizes with taxanes in triple negative breast cancer
- Effect of mechanochemical activation of natural phosphorite structure as well as phosphorus solubility
- Automated content analysis across six languages
- A deep learning reconstruction framework for X-ray computed tomography with incomplete data
- Integrating interconception care in preventive child health care services: The Healthy Pregnancy 4 All program
- The prognostic significance of tumor-infiltrating lymphocytes assessment with hematoxylin and eosin sections in resected primary lung adenocarcinoma
- Effectiveness of novel fabrics to resist punctures and lacerations from white shark (Carcharodon carcharias): Implications to reduce injuries from shark bites
- Bacillus Calmette-Guérin (BCG) therapy lowers the incidence of Alzheimer’s disease in bladder cancer patients
- Serial block-face scanning electron microscopy reveals neuronal-epithelial cell fusion in the mouse cornea
- Salt or fish (or salted fish)? The Bronze Age specialised sites along the Tyrrhenian coast of Central Italy: New insights from Caprolace settlement
- Pragmatic language dysfunction in systemic lupus erythematosus patients: Results from a single center Italian study
- Association between cerebral atrophy and osteoporotic vertebral compression fractures
- Latitudinal gradient of cyanobacterial diversity in tidal flats
- Gene expression based survival prediction for cancer patients—A topic modeling approach
- Understanding allergic multimorbidity within the non-eosinophilic interactome
- The association between psychological distress and angina pectoris: A population-based study
- Comparative analysis on Facebook post interaction using DNN, ELM and LSTM
- Cerebellum-mediated trainability of eye and head movements for dynamic gazing
- Psychological and physiological effects of applying self-control to the mobile phone
- Omecamtiv mecarbil lowers the contractile deficit in a mouse model of nebulin-based nemaline myopathy
- Genome-wide SNP analyses reveal population structure of Portunus pelagicus along Vietnam coastline
- Modulating transcription through development of semi-synthetic yeast core promoters
- Left-handed metamaterial bandpass filter for GPS, Earth Exploration-Satellite and WiMAX frequency sensing applications
- Cost-effectiveness analysis of PSA-based mass screening: Evidence from a randomised controlled trial combined with register data
- A good tennis player does not lose matches. The effects of valence congruency in processing stance-argument pairs
- Validation of the group tasks uncertainty model (MITAG) in a German sample
- Parent psychological wellbeing in a single-family room versus an open bay neonatal intensive care unit
- Optimizing the procedure of grain nutrient predictions in barley via hyperspectral imaging
- In-situ time resolved spectrographic measurement using an additively manufactured metallic micro-fluidic analysis platform
- Race disparity in blood sphingolipidomics associated with lupus cardiovascular comorbidity
- Characterization of the placental transcriptome through mid to late gestation in the mare
- Indirect violence exposure and mental health symptoms among an urban public-school population: Prevalence and correlates
- Diagnostic ability of multifocal electroretinogram in early multiple sclerosis using a new signal analysis method
- Predictors of never having a mammogram among Chinese, Vietnamese, and Korean immigrant women in the U.S.
- The impact of hepatic steatosis on portal hypertension
- How do and could clinical guidelines support patient-centred care for women: Content analysis of guidelines
- Study of the epidemiological behavior of malaria in the Darien Region, Panama. 2015–2017
- School-based obesity prevention for busy low-income families—Organisational and personal barriers and facilitators to implementation
- Neighborhood crime, disorder and substance use in the Caribbean context: Jamaica National Drug Use Prevalence Survey 2016
- Genomic comparison of diverse Salmonella serovars isolated from swine
- Significance of the lobe-specific emphysema index to predict prolonged air leak after anatomical segmentectomy
- Modeling of inter-organizational coordination dynamics in resilience planning of infrastructure systems: A multilayer network simulation framework
- Manipulating the odds: The effects of Machiavellianism and construal level on cheating behavior
- Early recognition of anorexia through patient-generated assessment predicts survival in patients with oesophagogastric cancer
- Identifying publications in questionable journals in the context of performance-based research funding
- ITGAM is a risk factor to systemic lupus erythematosus and possibly a protection factor to rheumatoid arthritis in patients from Mexico
- Nurses’ and patients’ experiences and preferences of the ankle-brachial pressure index and multi-site photoplethysmography for the diagnosis of peripheral arterial disease: A qualitative study
- Cluster tendency assessment in neuronal spike data
- Voluntary medical male circumcision for HIV prevention among adolescents in Kenya: Unintended consequences of pursuing service-delivery targets
- Primary care in five European countries: A citizens’ perspective on the quality of care for children
- High Order Profile Expansion to tackle the new user problem on recommender systems
- Psychometric properties of the Korean version of the Health Literacy on Social Determinants of Health Questionnaire (K-HL-SDHQ)
- Flood hazard mapping and assessment in data-scarce Nyaungdon area, Myanmar
- Methods for the identification of farm escapees in feral mink (Neovison vison) populations
- Transcriptional analysis of amino acid, metal ion, vitamin and carbohydrate uptake in butanol-producing Clostridium beijerinckii NRRL B-598
- Long-term vancomycin use had low risk of ototoxicity
- Overcoming platinum resistance in ovarian cancer by targeting pregnancy-associated plasma protein-A
- Exploration of muscle loss and metabolic state during prolonged critical illness: Implications for intervention?
- Pan-caspase inhibitor F573 mitigates liver ischemia reperfusion injury in a murine model
- Efficacy of interleukin 10 gene hydrofection in pig liver vascular isolated ‘in vivo’ by surgical procedure with interest in liver transplantation
- Molecular characteristics of segment 5, a unique fragment encoding two partially overlapping ORFs in the genome of rice black-streaked dwarf virus
- Early economic evaluation of MRI-guided laser interstitial thermal therapy (MRgLITT) and epilepsy surgery for mesial temporal lobe epilepsy
- GLADS: A gel-less approach for detection of STMS markers in wheat and rice
- Anterior tooth-use behaviors among early modern humans and Neandertals
- Incidence patterns of orofacial clefts in purebred dogs
- Capacity of the medullary cavity of tibia and femur for intra-bone marrow transplantation in mice
- Association of thoracic spine deformity and cardiovascular disease in a mouse model for Marfan syndrome
- Predicting atrial fibrillation in primary care using machine learning
- M3VR—A multi-stage, multi-resolution, and multi-volumes-of-interest volume registration method applied to 3D endovaginal ultrasound
- A developmental trajectory supporting the evaluation and achievement of competencies: Articulating the Mastery Rubric for the nurse practitioner (MR-NP) program curriculum
- Mobile medication manager application to improve adherence with immunosuppressive therapy in renal transplant recipients: A randomized controlled trial
- Default Mode Network structural alterations in Kocher-Monro trajectory white matter transection: A 3 and 7 tesla simulation modeling approach
- Phylogenetic revision of Gymnotidae (Teleostei: Gymnotiformes), with descriptions of six subgenera
- Population genetic analysis of 36 Y-chromosomal STRs yields comprehensive insights into the forensic features and phylogenetic relationship of Chinese Tai-Kadai-speaking Bouyei
- Prevention of suicidal behaviour: Results of a controlled community-based intervention study in four European countries
- An assessment of khat consumption habit and its linkage to household economies and work culture: The case of Harar city
- Fixation of genetic variation and optimization of gene expression: The speed of evolution in isolated lizard populations undergoing Reverse Island Syndrome
- One simple claudication question as first step in Peripheral Arterial Disease (PAD) screening: A meta-analysis of the association with reduced Ankle Brachial Index (ABI) in 27,945 subjects
- Direct cost of health care for individuals with community associated Clostridium difficile infections: A population-based cohort study
- Association between serum homocysteine level and cognitive function in middle-aged type 2 diabetes mellitus patients
- A qualitative research synthesis of contextual factors contributing to female overweight and obesity over the life course in sub-Saharan Africa
- Insight into the relationship between aryl-hydrocarbon receptor and β-catenin in human colon cancer cells
- Hidden noise in immunologic parameters might explain rapid progression in early-onset periodontitis
- The role of stigma in the acceptance and disclosure of HIV among recently diagnosed men who have sex with men in Australia: A qualitative study
- Detection of Schistosoma japonicum and Oncomelania hupensis quadrasi environmental DNA and its potential utility to schistosomiasis japonica surveillance in the Philippines
- Does age influence the quality of life in children with atopic dermatitis?
- Questioning the lasting effect of galvanic vestibular stimulation on postural control
- Identification of a novel monocytic phenotype in Classic Hodgkin Lymphoma tumor microenvironment
- Characterization of 20 complete plastomes from the tribe Laureae (Lauraceae) and distribution of small inversions
- Binding and dynamics of melatonin at the interface of phosphatidylcholine-cholesterol membranes
- Recent climate-driven ecological change across a continent as perceived through local ecological knowledge
- Nonalcoholic fatty liver disease is an early predictor of metabolic diseases in a metabolically healthy population
- Occurrence and multilocus genotyping of Giardia duodenalis from post-weaned dairy calves in Sichuan province, China
- Retinoic acid-stimulated ERK1/2 pathway regulates meiotic initiation in cultured fetal germ cells
- Gender disparities in scientific production: A nationwide assessment among physicians in Peru
- Effect of F1 and F2 generations on genetic variability and working steps of doubled haploid production in maize
- Mitochondrial dysfunction in rheumatoid arthritis: A comprehensive analysis by integrating gene expression, protein-protein interactions and gene ontology data
- A caspase-6-cleaved fragment of Glial Fibrillary Acidic Protein as a potential serological biomarker of CNS injury after cardiac arrest
- A handy method to remove bacterial contamination from fungal cultures
- The self-care profiles and its determinants among adults with hypertension in primary health care clinics in Selangor, Malaysia
- The mutational landscape of quinolone resistance in Escherichia coli
- Exploring the influence of self-perceptions on the relationship between motor competence and identity in adolescents
- Study on the damage characteristics of gas-bearing shale under different unloading stress paths
- EPILAT-IRA Study: A contribution to the understanding of the epidemiology of acute kidney injury in Latin America
- 16S rDNA droplet digital PCR for monitoring bacterial DNAemia in bloodstream infections
- Three-dimensional (3D) brain microphysiological system for organophosphates and neurochemical agent toxicity screening
- Diversity of endocervical microbiota associated with genital Chlamydia trachomatis infection and infertility among women visiting obstetrics and gynecology clinics in Malaysia
- Health impact of hepatic-venous-occlusive disease in a small town in Ethiopia—Case study from Tahtay koraro district in Tigray region, 2017
- Development of a novel automatable fabrication method based on electrospinning co electrospraying for rotator cuff augmentation patches
- Development of a quantitative PCR assay for the detection and enumeration of a potentially ciguatoxin-producing dinoflagellate, Gambierdiscus lapillus (Gonyaulacales, Dinophyceae)
- Association of clinical factors with survival outcomes in laryngeal squamous cell carcinoma (LSCC)
- Seasonal oyster harvesting recorded in a Late Archaic period shell ring
- Population preferences for breast cancer screening policies: Discrete choice experiment in Belarus
- Respiratory health and inflammatory markers - Exposure to respirable dust and quartz and chemical binders in Swedish iron foundries
- Trends and predictors of mother-to-child transmission of HIV in an era of protocol changes: Findings from two large health facilities in North East Nigeria
- Elevated Ki-67 (MIB-1) expression as an independent predictor for unfavorable pathologic outcomes and biochemical recurrence after radical prostatectomy in patients with localized prostate cancer: A propensity score matched study
- Genome-wide identification and gene expression analysis of SOS family genes in tuber mustard (Brassica juncea var. tumida)
- Carvedilol improves glucose tolerance and insulin sensitivity in treatment of adrenergic overdrive in high fat diet-induced obesity in mice
- Institutional differences in USMLE Step 1 and 2 CK performance: Cross-sectional study of 89 US allopathic medical schools
- Molecular epidemiological characteristics of dengue virus carried by 34 patients in Guangzhou in 2018
- Heteroplasmy in the complete chicken mitochondrial genome
- Candida blood stream infections observed between 2011 and 2016 in a large Italian University Hospital: A time-based retrospective analysis on epidemiology, biofilm production, antifungal agents consumption and drug-susceptibility
- Sixty years since the creation of Lake Kariba: Thermal and oxygen dynamics in the riverine and lacustrine sub-basins
- Association of uric acid in serum and urine with subclinical renal damage: Hanzhong Adolescent Hypertension Study
- Appropriate management of acute gastroenteritis in Australian children: A population-based study
- The plasma metabolome of women in early pregnancy differs from that of non-pregnant women
- Effectiveness of four types of neuraminidase inhibitors approved in Japan for the treatment of influenza
- More than just availability: Who has access and who administers take-home naloxone in Baltimore, MD
- Evaluating the cross-cultural validity of the Dutch version of the Social Exclusion Index for Health Surveys (SEI-HS): A mixed methods study
- Diminuendo al bottom—Clarifying the semantics of music notation by re-modeling
- Structural analysis of the manganese transport regulator MntR from Bacillus halodurans in apo and manganese bound forms
- Serum uromodulin is associated with the severity of clinicopathological findings in ANCA-associated glomerulonephritis
- Male support for cervical cancer screening and treatment in rural Ghana
- ADAPTS: Automated deconvolution augmentation of profiles for tissue specific cells
- Comparison of shape quantification methods for genomic prediction, and genome-wide association study of sorghum seed morphology
- An attempt to identify the issues underlying the lack of consistent conceptualisations in the field of student mathematics-related beliefs
- Video abstracts and plain language summaries are more effective than graphical abstracts and published abstracts
- Trophic structure of the macrofauna associated to deep-vents of the southern Gulf of California: Pescadero Basin and Pescadero Transform Fault
- Incomplete insertion of pedicle screws in a standard construct reduces the fatigue life: A biomechanical analysis
- Cost savings associated with timely treatment of botulism with botulism antitoxin heptavalent product
- Effects of light and nitrogen availability on photosynthetic efficiency and fatty acid content of three original benthic diatom strains
- Early signal detection of adverse events following influenza vaccination using proportional reporting ratio, Victoria, Australia
- Bioinformatic analysis of a novel Echinococcus granulosus nuclear receptor with two DNA binding domains
- Genome-wide identification and characterization, phylogenetic comparison and expression profiles of SPL transcription factor family in B. juncea (Cruciferae)
- Hypoxia inhibits TNF-α-induced TSLP expression in keratinocytes
- Conceptualising alcohol consumption in relation to long-term health conditions: Exploring risk in interviewee accounts of drinking and taking medications
- Elevated interleukin-25 and its association to Th2 cytokines in systemic lupus erythematosus with lupus nephritis
- Thrombocytopenia and thrombocytosis are associated with different outcome in atrial fibrillation patients on anticoagulant therapy
- Involvement of extracellular vesicles in the macrophage-tumor cell communication in head and neck squamous cell carcinoma
- Comparison of Humphrey Field Analyzer and imo visual field test results in patients with glaucoma and pseudo-fixation loss
- Out-of-pocket expenditure and catastrophic health expenditure for hospitalization due to injuries in public sector hospitals in North India
- Concurrent validity and discriminative ability of Dutch performance-based motor tests in 5 to 6 years old children
- Cumulative viral load as a predictor of CD4+ T-cell response to antiretroviral therapy using Bayesian statistical models
- Can General Practitioners manage mental disorders in primary care? A partially randomised, pragmatic, cluster trial
- Self-serving incentives impair collective decisions by increasing conformity
- Mutation and immune profiling of metaplastic breast cancer: Correlation with survival
- The clinicopathological significance of Thrombospondin-4 expression in the tumor microenvironment of gastric cancer
- Propofol-based total intravenous anesthesia did not improve survival compared to desflurane anesthesia in breast cancer surgery
- Association between ossification of the posterior longitudinal ligament and ossification of the nuchal ligament in the cervical spine
- Effects of Debaryomyces hansenii treatment on intestinal mucosa microecology in mice with antibiotic-associated diarrhea
- Molecular validation of clinical Pantoea isolates identified by MALDI-TOF
- A novel wheat lodging resistance evaluation method and device based on the thrust force of the stalks
- Evolution of high tooth replacement rates in theropod dinosaurs
- Outpatient facility-based order variation in combined imaging
- Ethnic-racial identity affirmation: Validation in Aboriginal Australian children
- Non-intubated anesthesia in patients undergoing video-assisted thoracoscopic surgery: A systematic review and meta-analysis
- Tissue-type plasminogen activator selectively inhibits multiple toll-like receptors in CSF-1-differentiated macrophages
- Changes of serum pentraxin-3 and hypersensitive CRP levels during pregnancy and their relationship with gestational diabetes mellitus
- Synergistic immuno-modulatory activity in human macrophages of a medicinal mushroom formulation consisting of Reishi, Shiitake and Maitake
- Investigating reindeer pastoralism and exploitation of high mountain zones in northern Mongolia through ice patch archaeology
- Diversity pattern of Plasmodium knowlesi merozoite surface protein 4 (MSP4) in natural population of Malaysia
- Protein synthesis rates of muscle, tendon, ligament, cartilage, and bone tissue in vivo in humans
- “What gets measured better gets done better”: The landscape of validation of global maternal and newborn health indicators through key informant interviews
- Contactless monitoring of heart and respiratory rate in anesthetized pigs using infrared thermography
- Molecular characterisation of genital human papillomavirus among women in Southwestern, Nigeria
- The impact of “male clinics” on health-seeking behaviors of adult men in rural Kenya
- Gene expression microarray public dataset reanalysis in chronic obstructive pulmonary disease
- Utility of the new cobas HCV test for viral load monitoring during direct-acting antiviral therapy
- Impact of negative tuberculin skin test on growth among disadvantaged Bangladeshi children
- Streptococcal phosphotransferase system imports unsaturated hyaluronan disaccharide derived from host extracellular matrices
- Maternal diet modulates placental nutrient transporter gene expression in a mouse model of diabetic pregnancy
- Effects of an incremental theory of personality intervention on the reciprocity between bullying and cyberbullying victimization and perpetration in adolescents
- The clot thickens: Autologous and allogeneic fibrin sealants are mechanically equivalent in an ex vivo model of cartilage repair
- Reproducibility, stability, and accuracy of microbial profiles by fecal sample collection method in three distinct populations
- Cooperation with autonomous machines through culture and emotion
- Variation in hybridogenetic hybrid emergence between populations of water frogs from the Pelophylax esculentus complex
- Breast cancer in Tanzanian, black American, and white American women: An assessment of prognostic and predictive features, including tumor infiltrating lymphocytes
- Intramolecular tautomerization of the quercetin molecule due to the proton transfer: QM computational study
- A global overview of cassava genetic diversity
- Whole body periodic acceleration in normal and reduced mucociliary clearance of conscious sheep
- Identifying resurrection genes through the differentially expressed genes between Selaginella tamariscina (Beauv.) spring and Selaginella moellendorffii Hieron under drought stress
- Impact of hemodialysis on the concentrations of sodium and potassium during infusion of sodium thiosulfate using an In Vitro hemodialysis model
- Minimal effects of oyster aquaculture on local water quality: Examples from southern Chesapeake Bay
- Suboptimal infant and young child feeding practices in rural Boucle du Mouhoun, Burkina Faso: Findings from a cross-sectional population-based survey
- High salinity tolerance of invasive blue catfish suggests potential for further range expansion in the Chesapeake Bay region
- From waste to food: Optimising the breakdown of oil palm waste to provide substrate for insects farmed as animal feed
- Quantitative assessment of interstitial lung disease in Sjögren’s syndrome
- Comparative efficacy of tenofovir and entecavir in nucleos(t)ide analogue-naive chronic hepatitis B: A systematic review and meta-analysis
- Reference ranges for ultrasonographic renal dimensions as functions of age and body indices: A retrospective observational study in Taiwan
- Finding phrases: On the role of co-verbal facial information in learning word order in infancy
- Mathematical modeling reveals the factors involved in the phenomena of cancer stem cells stabilization
- Effects of forest management and roe deer impact on a mountain forest development in the Italian Apennines: A modelling approach using LANDIS-II
- Evaluation of comprehensive improvement for mild and moderate soil salinization in arid zone
- Efficacy, acceptability and feasibility of daily text-messaging in promoting glycaemic control and other clinical outcomes in a low-resource setting of South Africa: A randomised controlled trial
- Magnitude and associated factors of postpartum depression among women in Nekemte town, East Wollega zone, west Ethiopia, 2019: A community-based study
- Comparison of continuous wave and cold lateral condensation filling techniques in 3D printed simulated C-shape canals instrumented with Reciproc Blue or Hyflex EDM
- Effect of caffeine on neuromuscular function following eccentric-based exercise
- AtUBL5 regulates growth and development through pre-mRNA splicing in Arabidopsis thaliana
- The gut microbiome of freshwater Unionidae mussels is determined by host species and is selectively retained from filtered seston
- Alcohol consumption and survival after breast cancer diagnosis in Japanese women: A prospective patient cohort study
- Selection of reference genes for normalization of cranberry (Vaccinium macrocarpon Ait.) gene expression under different experimental conditions
- The household economic costs associated with depression symptoms: A cross-sectional household study conducted in the North West province of South Africa
- Increased cell size, structural complexity and migration of cancer cells acquiring fibroblast organelles by cell-projection pumping
- Acute low- compared to high-load resistance training to failure results in greater energy expenditure during exercise in healthy young men
- Impact of body mass index and metabolically unhealthy status on mortality in the Japanese general population: The JMS cohort study
- Characterization of two thermophilic cellulases from Talaromyces leycettanus JCM12802 and their synergistic action on cellulose hydrolysis
- Ecohydrology of urban trees under passive and active irrigation in a semiarid city
- Cyclosporine A eyedrops with self-nanoemulsifying drug delivery systems have improved physicochemical properties and efficacy against dry eye disease in a murine dry eye model
- LFastqC: A lossless non-reference-based FASTQ compressor
- Highly accurate prediction of flammability limits of chemical compounds using novel integrated hybrid models
- Nonsteroidal anti-inflammatory drugs and acetaminophen ameliorate muscular mechanical hyperalgesia developed after lengthening contractions via cyclooxygenase-2 independent mechanisms in rats
- A popular Indian clove-based mosquito repellent is less effective against Culex quinquefasciatus and Aedes aegypti than DEET
- Yeasts affect tolerance of Drosophila melanogaster to food substrate with high NaCl concentration
- The effect of climate change on cholera disease: The road ahead using artificial neural network
- Grit (effortful persistence) can be measured with a short scale, shows little variation across socio-demographic subgroups, and is associated with career success and career engagement
- Micro-dislodgement during transcatheter aortic valve implantation with a contemporary self-expandable prosthesis
- Improving the antimicrobial efficacy against resistant Staphylococcus aureus by a combined use of conjugated oligoelectrolytes
- Kin discrimination and outer membrane exchange in Myxococcus xanthus: Experimental analysis of a natural population
- Inflammatory cell infiltrates, hypoxia, vascularization, pentraxin 3 and osteoprotegerin in abdominal aortic aneurysms – A quantitative histological study
- Effects of virtual reality rehabilitation training on gait and balance in patients with Parkinson's disease: A systematic review
- Serum miR-33a is associated with steatosis and inflammation in patients with non-alcoholic fatty liver disease after liver transplantation
- Association between housing tenure and self-rated health in Japan: Findings from a nationwide cross-sectional survey
- Investigation of biochemical and physiological parameters of the newborn Saiga antelope (Saiga tatarica) in Gansu Province, China
- One-year follow-up of changes in refraction and aberrations induced by corneal incision
- Evaluation of upper limb superficial venous percussion as a sign of anatomical location and venous permeability. A comparative study of superficial venous percussion to ultrasound findings on non-renal patients and on chronic kidney disease patients
- An assessment of the Dutch experience with health insurers acting as healthcare advisors
- Perception of potential harm and benefits of HIV vaccine trial participation: A qualitative study from urban Tanzania
- Veterans with Gulf War Illness exhibit distinct respiratory patterns during maximal cardiopulmonary exercise
- Deep brain stimulation restores the glutamatergic and GABAergic synaptic transmission and plasticity to normal levels in kindled rats
- Metformin strongly affects transcriptome of peripheral blood cells in healthy individuals
- Cranberry extracts promote growth of Bacteroidaceae and decrease abundance of Enterobacteriaceae in a human gut simulator model
- Long-term retention on antiretroviral therapy among infants, children, adolescents and adults in Malawi: A cohort study
- Histochemical quantification of collagen content in articular cartilage
- Optogenetically transduced human ES cell-derived neural progenitors and their neuronal progenies: Phenotypic characterization and responses to optical stimulation
- Ion torrent high throughput mitochondrial genome sequencing (HTMGS)
- Outpatient antibiotic prescription rate and pattern in the private sector in India: Evidence from medical audit data
- Acute Influenza A virus outbreak in an enzootic infected sow herd: Impact on viral dynamics, genetic and antigenic variability and effect of maternally derived antibodies and vaccination
- Prevalence and correlates of low serum calcium in late pregnancy: A cross sectional study in the Nkongsamba Regional Hospital; Littoral Region of Cameroon
- Home-cage monitoring ascertains signatures of ictal and interictal behavior in mouse models of generalized seizures
- CRISPR/Cas9 gene editing in the West Nile Virus vector, Culex quinquefasciatus Say
- Genetic susceptibility to angiotensin-converting enzyme-inhibitor induced angioedema: A systematic review and evaluation of methodological approaches
- Proton pump inhibitor use increases the risk of peritonitis in peritoneal dialysis patients
- Comparative distribution of extended-spectrum beta-lactamase–producing Escherichia coli from urine infections and environmental waters
- Sex differences in thigh muscle volumes, sprint performance and mechanical properties in national-level sprinters
- Maternal serum and cord blood leptin concentrations at delivery
- Winter nitrification in ice-covered lakes
- Intolerance of uncertainty fuels depressive symptoms through rumination: Cross-sectional and longitudinal studies
- Monitoring exercise-induced muscle damage indicators and myoelectric activity during two weeks of knee extensor exercise training in young and old men
- Can adoption of pollution prevention techniques reduce pollution substitution?
- The association between self-efficacy and self-management behaviors among Chinese patients with type 2 diabetes
- Poly-arginine-18 peptides do not exacerbate bleeding, or improve functional outcomes following collagenase-induced intracerebral hemorrhage in the rat
- Affective disorders in the elderly in different European countries: Results from the MentDis_ICF65+ study
- Evaluation of forearm vascular resistance during orthostatic stress: Velocity is proportional to flow and size doesn’t matter
- Proton pencil minibeam irradiation of an in-vivo mouse ear model spares healthy tissue dependent on beam size
- Maternal stress in Shank3ex4-9 mice increases pup-directed care and alters brain white matter in male offspring
- Aspartate aminotransferase-to-platelet ratio index (APRI): A potential marker for diagnosis in patients at risk of severe malaria caused by Plasmodium vivax
- Exploiting open source 3D printer architecture for laboratory robotics to automate high-throughput time-lapse imaging for analytical microbiology
- Long non-coding RNAs and latent HIV – A search for novel targets for latency reversal
- Clinical characteristics of neonatal fulminant necrotizing enterocolitis in a tertiary Children's hospital in the last 10 years
- Effects of neuromuscular electrical stimulation training on muscle size in collegiate track and field athletes
- Adaptive fuzzy flow rate control considering multifractal traffic modeling and 5G communications
- Evaluation of four commercial tests for detecting ceftiofur in waste milk bulk tank samples
- A smart tele-cytology point-of-care platform for oral cancer screening
- Vasopressin SNP pain factors and stress in sickle cell disease
- Carbonate production of Micronesian reefs suppressed by thermal anomalies and Acanthaster as sea-level rises
- Microbial metabolisms in an abyssal ferromanganese crust from the Takuyo-Daigo Seamount as revealed by metagenomics
- Incidence of chronic kidney disease hospitalisations and mortality in Espírito Santo between 1996 to 2017
- The impact of short-term machine perfusion on the risk of cancer recurrence after rat liver transplantation with donors after circulatory death
- Proteomic profiling of the thrombin-activated canine platelet secretome (CAPS)
- Blood metal levels and serum testosterone concentrations in male and female children and adolescents: NHANES 2011–2012
- The effects of prolonged single night session of videogaming on sleep and declarative memory
- Diversity, distribution and dynamics of large trees across an old-growth lowland tropical rain forest landscape
- Mapping developmental QTL for plant height in soybean [Glycine max (L.) Merr.] using a four-way recombinant inbred line population
- Vaginal ring acceptability and related preferences among women in low- and middle-income countries: A systematic review and narrative synthesis
- UM171 induces a homeostatic inflammatory-detoxification response supporting human HSC self-renewal
- Positive selection and precipitation effects on the mitochondrial NADH dehydrogenase subunit 6 gene in brown hares (Lepus europaeus) under a phylogeographic perspective
- Evaluation of Minimum Inhibitory Concentrations for 154 Mycoplasma synoviae isolates from Italy collected during 2012-2017
- Enhancement of antibiotics antimicrobial activity due to the silver nanoparticles impact on the cell membrane
- Correction: Smoking, alcohol use disorder and tuberculosis treatment outcomes: A dual co-morbidity burden that cannot be ignored
- Correction: Effect of corruption on perceived difficulties in healthcare access in sub-Saharan Africa
- Knowledge-based best of breed approach for automated detection of clinical events based on German free text digital hospital discharge letters
- Importance of thorough tissue and cellular level characterization of targeted drugs in the evaluation of pharmacodynamic effects
- Integrated value-chain and risk assessment of Pig-Related Zoonoses in Ghana
- Failed sperm retrieval from severely oligospermic or non-obstructive azoospermic patients on oocyte retrieval day: Emergent oocyte cryopreservation is a feasible strategy
- Cassava yield traits predicted by genomic selection methods
- Verification of hub genes in the expression profile of aortic dissection
- Pig farmers’ willingness to pay for management strategies to reduce aggression between pigs
- Metabolomic response of Euglena gracilis and its bleached mutant strain to light
- Diagnostic value of ASVS for insulinoma localization: A systematic review and meta-analysis
- Newly educated care managers’ experiences of providing care for persons with stress-related mental disorders in the clinical primary care context
- Real-time telemetry monitoring of oxygen in the central complex of freely-walking Gromphadorhina portentosa
- Qualification programmes for immigrant health professionals: A systematic review
- An analytical model to minimize the latency in healthcare internet-of-things in fog computing environment
- Grain filling of early-season rice cultivars grown under mechanical transplanting
- Intercalation of small molecules into DNA in chromatin is primarily controlled by superhelical constraint
- Correlative evidence for co-regulation of phosphorus and carbon exchanges with symbiotic fungus in the arbuscular mycorrhizal Medicago truncatula
- How to design a dose-finding study on combined agents: Choice of design and development of R functions
- Altered expression of Notch1 in Alzheimer's disease
- The ZJU index is a powerful surrogate marker for NAFLD in severely obese North American women
- Trunk velocity-dependent Light Touch reduces postural sway during standing
- Evaluation of cytological diagnostic accuracy for canine splenic neoplasms: An investigation in 78 cases using STARD guidelines
- Trade-offs in motivating volunteer effort: Experimental evidence on voluntary contributions to science
- Does caching strategy vary with microclimate in endangered Mt. Graham red squirrels?
- Assessment of energy expenditure during high intensity cycling and running using a heart rate and activity monitor in young active adults
- Evaluating rectal swab collection method for gut microbiome analysis in the common marmoset (Callithrix jacchus)
- Implementation of a screening, brief intervention and referral to treatment programme for risky substance use in South African emergency centres: A mixed methods evaluation study
- Can the CalproQuest predict a positive Calprotectin test? A prospective diagnostic study
- The calcium sensor OsCBL1 modulates nitrate signaling to regulate seedling growth in rice
- Acceptability of and treatment preferences for recurrent bacterial vaginosis—Topical lactic acid gel or oral metronidazole antibiotic: Qualitative findings from the VITA trial
- Mathematical determination of the HIV-1 matrix shell structure and its impact on the biology of HIV-1
- Contingent negative variation during a modified cueing task in simulated driving
- CAMDI interacts with the human memory-associated protein KIBRA and regulates AMPAR cell surface expression and cognition
- Effect of feeding patterns on growth and nutritional status of children aged 0-24 months: A Chinese cohort study
- A fecal sequel: Testing the limits of a genetic assay for bat species identification
- Measuring the impact of chronic conditions and associated multimorbidity on health-related quality of life in the general population in Hong Kong SAR, China: A cross-sectional study
- Short and long-term clinical effectiveness and cost-effectiveness of a late-phase community-based balance and gait exercise program following hip fracture. The EVA-Hip Randomised Controlled Trial
- Vaccine cold chain in general practices: A prospective study in 75 refrigerators (Keep Cool study)
- Brazilian norms for the Bank of Standardized Stimuli (BOSS)
- Distinct varieties of aesthetic chills in response to multimedia
- Interaction between apolipoprotein E genotype and hypertension on cognitive function in older women in the Nurses’ Health Study
- Correction: Resistance profile of the HIV-1 maturation inhibitor GSK3532795 in vitro and in a clinical study
- New formulation of the Gompertz equation to describe the kinetics of untreated tumors
- Development of visual perception of others’ actions: Children’s judgment of lifted weight
- Retrospective comparative analysis of intraocular lens calculation formulas after hyperopic refractive surgery
- Human vitreous concentrations of citicoline following topical application of citicoline 2% ophthalmic solution
- Development and validation of exhaled breath condensate microRNAs to identify and endotype asthma in children
- Arthroscopic release for frozen shoulder: Does the timing of intervention and diabetes affect outcome?
- Risk factors affecting dairy cattle protective grouping behavior, commonly known as bunching, against Stomoxys calcitrans (L.) on California dairies
- Acceleration of chemical shift encoding-based water fat MRI for liver proton density fat fraction and T2* mapping using compressed sensing
- Characterisation and microbial community analysis of lipid utilising microorganisms for biogas formation
- Sexuality in male partners of women with fibromyalgia syndrome: A qualitative study
- Exploring optimization strategies for improving explicit water models: Rigid n-point model and polarizable model based on Drude oscillator
- Artificial insemination with fresh, liquid stored and frozen thawed semen in dromedary camels
- Moving into an urban drug scene among people who use drugs in Vancouver, Canada: Latent class growth analysis
- Numerical study on the start and unstart phenomena in a scramjet inlet-isolator model
- Effects of dietary supplementation with apple peel powder on the growth, blood and liver parameters, and transcriptome of genetically improved farmed tilapia (GIFT, Oreochromis niloticus)
- Urban growth simulation in different scenarios using the SLEUTH model: A case study of Hefei, East China
- Chronic bronchitis without airflow obstruction, asthma and rhinitis are differently associated with cardiovascular risk factors and diseases
- Factors associated with medication adherence among people with diabetes mellitus in poor urban areas of Cambodia: A cross-sectional study
- Mammary microbiome of lactating organic dairy cows varies by time, tissue site, and infection status
- Force field generalization and the internal representation of motor learning
- Polyphenism of visual and chemical secondary sexually-selected wing traits in the butterfly Bicyclus anynana: How different is the intermediate phenotype?
- Minimal genetic differentiation of the malaria vector Nyssorhynchus darlingi associated with forest cover level in Amazonian Brazil
- The impact of leisure activities on older adults’ cognitive function, physical function, and mental health
- scafSLICR: A MATLAB-based slicing algorithm to enable 3D-printing of tissue engineering scaffolds with heterogeneous porous microarchitecture
- Association of serum leptin and adiponectin concentrations with echocardiographic parameters and pathophysiological states in patients with cardiovascular disease receiving cardiovascular surgery
- Operation of cognitive memory inhibition in adults with Down syndrome: Effects of maintenance load and material
- Influences on surgical antimicrobial prophylaxis decision making by surgical craft groups, anaesthetists, pharmacists and nurses in public and private hospitals
- Post-treatment Lyme disease symptoms score: Developing a new tool for research
- Expression of Concern: The Role of the RACK1 Ortholog Cpc2p in Modulating Pheromone-Induced Cell Cycle Arrest in Fission Yeast
- Equine bronchial fibroblasts enhance proliferation and differentiation of primary equine bronchial epithelial cells co-cultured under air-liquid interface
- Investigating cooperation with robotic peers
- Synthesis, purification and crystallization of a putative critical bulge of HAR1 RNA
- Prosthetic push-off power in trans-tibial amputee level ground walking: A systematic review
- A case study of the use of verbal reports for talent identification purposes in soccer: A Messi affair!
- Transgenerational deep sequencing revealed hypermethylation of hippocampal mGluR1 gene with altered mRNA expression of mGluR5 and mGluR3 associated with behavioral changes in Sprague Dawley rats with history of prolonged febrile seizure
- Obesity is associated with an impaired survival in lymphoma patients undergoing autologous stem cell transplantation
- Periodontal disease: Repercussions in pregnant woman and newborn health—A cohort study
- Origins of Chinese reindeer (Rangifer tarandus) based on mitochondrial DNA analyses
- Regional, racial, gender, and tumor biology disparities in breast cancer survival rates in Africa: A systematic review and meta-analysis
- How effective are films in inducing positive and negative emotional states? A meta-analysis
- 3D nanostructural characterisation of grain boundaries in atom probe data utilising machine learning methods
- An outbreak of tuberculosis in a middle school in Henan, China: Epidemiology and risk factors
- Initial clinical radiological findings and staging to predict prognosis of primary hepatic angiosarcoma: A retrospective analysis
- A new early Eocene deperetellid tapiroid illuminates the origin of Deperetellidae and the pattern of premolar molarization in Perissodactyla
- Longevity and marginal bone loss of narrow-diameter implants supporting single crowns: A systematic review
- Impact of UVC-sustained recirculating air filtration on airborne bacteria and dust in a pig facility
- Cold-related Florida manatee mortality in relation to air and water temperatures
- Conceptual fluency in inductive reasoning
- Clinical outcomes and treatment patterns among Medicare patients with nonvalvular atrial fibrillation (NVAF) and chronic kidney disease
- Improvements in the learnability of smartphone haptic interfaces for visually impaired users
- Role of the malic enzyme in metabolism of the halotolerant methanotroph Methylotuvimicrobium alcaliphilum 20Z
- Cyclic loading test study on a new cast-in-situ insulated sandwich concrete wall
- Natural compounds as angiogenic enzyme thymidine phosphorylase inhibitors: In vitro biochemical inhibition, mechanistic, and in silico modeling studies
- Analysis of virulence potential of Escherichia coli O145 isolated from cattle feces and hide samples based on whole genome sequencing
- Pre-clinical medical student reflections on implicit bias: Implications for learning and teaching
- Prognostic significance of non-sustained ventricular tachycardia on stored electrograms in pacemaker recipients
- Determinants of preterm birth among mothers who gave birth at public hospitals in the Amhara region, Ethiopia: A case-control study
- Real-world evidence of the effectiveness of ombitasvir-paritaprevir/r ± dasabuvir ± ribavirin in patients monoinfected with chronic hepatitis C or coinfected with human immunodeficiency virus-1 in Spain
- Unique transcriptomic landscapes identified in idiopathic spontaneous and infection related preterm births compared to normal term births
- Restrained expansion of the recall germinal center response as biomarker of protection for influenza vaccination in mice
- Arabidopsis TRM5 encodes a nuclear-localised bifunctional tRNA guanine and inosine-N1-methyltransferase that is important for growth
- Achievement of weight loss in patients with overweight during dietetic treatment in primary health care
- Autophagy deficiency exacerbates colitis through excessive oxidative stress and MAPK signaling pathway activation
- The impacts of parity on lung function data (LFD) of healthy females aged 40 years and more issued from an upper middle income country (Algeria): A comparative study
- Reorganization of spatial configurations in visual working memory: A matter of set size?
- Unravelling travellers’ route choice behaviour at full-scale urban network by focusing on representative OD pairs in computer experiments
- Evaluating the higher-order structure of the Profile of Emotional Competence (PEC): Confirmatory factor analysis and Bayesian structural equation modeling
- HIV prevalence and correlated factors among male clients of female sex workers in a border region of China
- Next generation sequencing and RNA-seq characterization of adipose tissue in the Nile crocodile (Crocodylus niloticus) in South Africa: Possible mechanism(s) of pathogenesis and pathophysiology of pansteatitis
- Association between advanced maternal age and maternal and neonatal morbidity: A cross-sectional study on a Spanish population
- Ethnic differences in the prevalence, socioeconomic and health related risk factors of knee pain and osteoarthritis symptoms in older Malaysians
- Increasing knowledge of HIV status in a country with high HIV testing coverage: Results from the Botswana Combination Prevention Project
- Friends with benefits: The effects of vegetative shading on plant survival in a green roof environment
- Comparison of the fecal, cecal, and mucus microbiome in male and female mice after TNBS-induced colitis
- Identifying candidate diagnostic markers for early stage of non-small cell lung cancer
- Complex alternative splicing of human Endonuclease V mRNA, but evidence for only a single protein isoform
- Correction: KML001 Induces Apoptosis and Autophagic Cell Death in Prostate Cancer Cells via Oxidative Stress Pathway
- Unique developmental trajectories of risk behaviors in adolescence and associated outcomes in young adulthood
- Enhanced fibrinolysis detection in a natural occurring canine model with intracavitary effusions: Comparison and degree of agreement between thromboelastometry and FDPs, D-dimer and fibrinogen concentrations
- Overexpression of Saussurea involucrata dehydrin gene SiDHN promotes cold and drought tolerance in transgenic tomato plants
- Foxtail millet (Setaria italica (L.) P. Beauv) CIPKs are responsive to ABA and abiotic stresses
- Autonomous drone hunter operating by deep learning and all-onboard computations in GPS-denied environments
- Heterogeneity Diffusion Imaging of gliomas: Initial experience and validation
- Frequency cluster formation and slow oscillations in neural populations with plasticity
- DHP23002 as a next generation oral paclitaxel formulation for pancreatic cancer therapy
- Diagnostic accuracy of SOX11 immunohistochemistry in mantle cell lymphoma: A meta-analysis
- Analytical solution to swing equations in power grids
- Pathways to conspiracy: The social and linguistic precursors of involvement in Reddit’s conspiracy theory forum
- Spatiotemporally random and diverse grid cell spike patterns contribute to the transformation of grid cell to place cell in a neural network model
- Empathic concern and personal distress depend on situational but not dispositional factors
- Who is more susceptible to job stressors and resources? Sensory-processing sensitivity as a personal resource and vulnerability factor
- Cost-effectiveness of integrating postpartum antiretroviral therapy and infant care into maternal & child health services in South Africa
- A substitution mutation in a conserved domain of mammalian acetate-dependent acetyl CoA synthetase 2 results in destabilized protein and impaired HIF-2 signaling
- One step at a time: Physical activity is linked to positive interpretations of ambiguity
- Calreticulin regulates vascular endothelial growth factor-A mRNA stability in gastric cancer cells
- Evaluation of various methods of selection of B. subtilis strains capable of secreting surface-active compounds
- Association between US Pharmacopeia (USP) monograph standards, generic entry and prescription drug costs
- Molecular characterisation of the synovial fluid microbiome in rheumatoid arthritis patients and healthy control subjects
- On sorption hysteresis in wood: Separating hysteresis in cell wall water and capillary water in the full moisture range
- Inbreeding, Allee effects and stochasticity might be sufficient to account for Neanderthal extinction
- Reliability and construct validity of the stepping-forward affordance perception test for fall risk assessment in community-dwelling older adults
- Socioeconomic determinants of nutritional status among ‘Baiga’ tribal children In Balaghat district of Madhya Pradesh: A qualitative study
- Study on characteristics of fire plume in building facade window under lateral blow
- ‘When you talk to someone in a bad way or always put her under pressure, it is actually worse than beating her’: Conceptions and experiences of emotional intimate partner violence in Rwanda and South Africa
- Effects of 6-mercaptopurine in pressure overload induced right heart failure
- The association between haemoglobin levels in the first 20 weeks of pregnancy and pregnancy outcomes
- Implementation and evaluation of an antimicrobial stewardship programme in companion animal clinics: A stepped-wedge design intervention study
- Factors associated with persistently high-cost health care utilization for musculoskeletal pain
- Nitrogen and chlorophyll status determination in durum wheat as influenced by fertilization and soil management: Preliminary results
- Effect of repeated in vivo microCT imaging on the properties of the mouse tibia
- Coupling environment and physiology to predict effects of climate change on the taxonomic and functional diversity of fish assemblages in the Murray-Darling Basin, Australia
- Hematology and plasma biochemistries in the Blanding’s turtle (Emydoidea blandingii) in Lake County, Illinois
- CRISPR-Cas influences the acquisition of antibiotic resistance in Klebsiella pneumoniae
- Phosphorylation-dependent activity-based conformational changes in P21-activated kinase family members and screening of novel ATP competitive inhibitors
- Antidepressant prescriptions, discontinuation, depression and perinatal outcomes, including breastfeeding: A population cohort analysis
- Why men with a low-risk prostate cancer select and stay on active surveillance: A qualitative study
- Imported severe malaria and risk factors for intensive care: A single-centre retrospective analysis
- Combined treatment (image-guided thrombectomy and endovascular therapy with open femoral access) for acute lower limb ischemia: Clinical efficacy and outcomes
- Low-latency single channel real-time neural spike sorting system based on template matching
- Quantifying the scale effect in geospatial big data using semi-variograms
- Paper-and-pencil versus computerized administration mode: Comparison of data quality and risk behavior prevalence estimates in the European school Survey Project on Alcohol and other Drugs (ESPAD)
- Regression adjusted colocalisation colour mapping (RACC): A novel biological visual analysis method for qualitative colocalisation analysis of 3D fluorescence micrographs
- Ostrich eggshell bead diameter in the Holocene: Regional variation with the spread of herding in eastern and southern Africa
- Spatial and temporal variations in female size at maturity of a Southern Rock Lobster (Jasus edwardsii) population: A likely response to climate change
- Inactive USP14 and inactive UCHL5 cause accumulation of distinct ubiquitinated proteins in mammalian cells
- Training rhesus macaques to take daily oral antiretroviral therapy for preclinical evaluation of HIV prevention and treatment strategies
- Left ventricular structural and functional changes in Friedreich ataxia – Relationship with body size, sex, age and genetic severity
- Magnitude and factors associated with anemia among pregnant women attending antenatal care in Bench Maji, Keffa and Sheka zones of public hospitals, Southwest, Ethiopia, 2018: A cross -sectional study
- Effectiveness of telerehabilitation in the management of adults with stroke: A systematic review
- Hydrogen sulphide-induced hypometabolism in human-sized porcine kidneys
- Correction: Comparison of the molecular properties of retinitis pigmentosa P23H and N15S amino acid replacements in rhodopsin
- Retraction: Regulation of gastric smooth muscle contraction via Ca2+-dependent and Ca2+-independent actin polymerization
- Evaluation of neutral oral contrast agents for assessment of the small bowel at abdominal staging CT
- Blood type and breed-associated differences in cell marker expression on equine bone marrow-derived mesenchymal stem cells including major histocompatibility complex class II antigen expression
- Induced abortion and future use of IVF treatment; A nationwide register study
- Psychosocial determinants of sustained maternal functional impairment: Longitudinal findings from a pregnancy-birth cohort study in rural Pakistan
- Measurement of finger joint angle using stretchable carbon nanotube strain sensor
- Determinants of mortality among patients with drug-resistant tuberculosis in northern Nigeria
- Drugs modulating stochastic gene expression affect the erythroid differentiation process
- Efficacy of UB0316, a multi-strain probiotic formulation in patients with type 2 diabetes mellitus: A double blind, randomized, placebo controlled study
- Prognostic value of des-γ-carboxy prothrombin in patients with hepatocellular carcinoma treated with transarterial chemotherapy: A systematic review and meta-analysis
- Avermectin induces the oxidative stress, genotoxicity, and immunological responses in the Chinese Mitten Crab, Eriocheir sinensis
- Antibiotic use in mandarin production (Citrus reticulata Blanco) in major mandarin-producing areas in Thailand: A survey assessment
- Application of CPI cutoff value based on parentage testing of duos and trios typed by four autosomal kits
- Correction: Good and Bad in the Hands of Politicians: Spontaneous Gestures during Positive and Negative Speech
- Adolescents with worse levels of oral health literacy have more cavitated carious lesions
- Effective methods for the inactivation of Francisella tularensis
- Detection of early-stage Alzheimer’s pathology using blood-based autoantibody biomarkers in elderly hip fracture repair patients
- Correlation between internal pudendal artery stenosis and erectile dysfunction in patients with suspected coronary artery disease
- Analysis of HER2 genomic binding in breast cancer cells identifies a global role in direct gene regulation
- Population productivity of shovelnose rays: Inferring the potential for recovery
- Correction: Long-term clinical outcomes in a cohort of patients with solitary plasmacytoma treated in the modern era
- Effects of tetracycline on myocardial infarct size in obese rats with chemically-induced colitis
- Mineral absorption is an enriched pathway in a brain region of restless legs syndrome patients with reduced MEIS1 expression
- Changes in weight and body composition across five years at university: A prospective observational study
- Adeno-associated virus-mediated expression of human butyrylcholinesterase to treat organophosphate poisoning
- Effects of insulin signaling on mouse taste cell proliferation
- Patient-level cost of home- and facility-based child pneumonia treatment in Suba Sub County, Kenya
- TAP: A static analysis model for PHP vulnerabilities based on token and deep learning technology
- Cost-effectiveness of QuantiFERON-TB Gold In-Tube versus tuberculin skin test for diagnosis and treatment of Latent Tuberculosis Infection in primary health care workers in Brazil
- Multifaceted intervention for the prevention and management of musculoskeletal pain in nursing staff: Results of a cluster randomized controlled trial
- Changes over time in creatinine clearance and comparison of emergent adverse events for HIV-positive adults receiving standard doses (300 mg/day) of lamivudine-containing antiretroviral therapy with baseline creatinine clearance of 30–49 vs ≥50 mL/min
- Population dynamics of foxes during restricted-area culling in Britain: Advancing understanding through state-space modelling of culling records
- Impacts of experimental advisory exit speed sign on traffic speeds for freeway exit ramp
- In-hospital outcomes and 30-day readmission rates among ischemic and hemorrhagic stroke patients with delirium
- Monitoring quality indicators for the Xpert MTB/RIF molecular assay in Ethiopia
- Delivering genes across the blood-brain barrier: LY6A, a novel cellular receptor for AAV-PHP.B capsids
- Correction: Using remote sensing to detect whale strandings in remote areas: The case of sei whales mass mortality in Chilean Patagonia
- Comparison of the inoculum size effects of antibiotics on IMP-6 β-lactamase-producing Enterobacteriaceae co-harboring plasmid-mediated quinolone resistance genes
- Contrast-enhanced computed tomography findings of canine primary renal tumors including renal cell carcinoma, lymphoma, and hemangiosarcoma
- Non-invasive in vivo imaging of UCP1 expression in live mice via near-infrared fluorescent protein iRFP720
- Overexpression of pink1 or parkin in indirect flight muscles promotes mitochondrial proteostasis and extends lifespan in Drosophila melanogaster
- Fiber stiffness, pore size and adhesion control migratory phenotype of MDA-MB-231 cells in collagen gels
- Comparison of two experimental ARDS models in pigs using electrical impedance tomography
- Are primary school children attending full-day school still engaged in sports clubs?
- Stroke risks in women with dysmenorrhea by age and stroke subtype
- Changes in patterns of mortality rates and years of life lost due to firearms in the United States, 1999 to 2016: A joinpoint analysis
- In vitro modeling of Batrachochytrium dendrobatidis infection of the amphibian skin
- Development and validation of LC-MS/MS method for imatinib and norimatinib monitoring by finger-prick DBS in gastrointestinal stromal tumor patients
- Correction: Habitat disturbance and the organization of bacterial communities in Neotropical hematophagous arthropods
- Characterisation of early metazoan secretion through associated signal peptidase complex subunits, prohormone convertases and carboxypeptidases of the marine sponge (Amphimedon queenslandica)
- Time trends between 2002 and 2017 in correlates of self-reported sitting time in European adults
- Performance of patient acuity rating by rapid response team nurses for predicting short-term prognosis
- Changes in HbA1c during the first six years after the diagnosis of Type 2 diabetes mellitus predict long-term microvascular outcomes
- Correction: Antimicrobial resistance genotypes and phenotypes of Campylobacter jejuni isolated in Italy from humans, birds from wild and urban habitats, and poultry
- Correction: Mental health and quality of life outcomes in family members of patients with chronic critical illness admitted to the intensive care units of two Brazilian hospitals serving the extremes of the socioeconomic spectrum
- Correction: Establishing an infrastructure for collaboration in primate cognition research
- Correction: The impact of public health insurance on health care utilisation, financial protection and health status in low- and middle-income countries: A systematic review
- Health provider and service-user experiences of sensory modulation rooms in an acute inpatient psychiatry setting
- Comparison of potential drug-drug interactions with metabolic syndrome medications detected by two databases
- The Polish version of the Cultural Intelligence Scale: Assessment of its reliability and validity among healthcare professionals and medical faculty students
- Selection of optimal reference genes for qRT-PCR analysis of shoot development and graviresponse in prostrate and erect chrysanthemums
- Metastasis risk prediction model in osteosarcoma using metabolic imaging phenotypes: A multivariable radiomics model
- Defining hospital community benefit activities using Delphi technique: A comparison between China and the United States
- Establishment of the experimental procedure for prediction of conjugation capacity in mutant UGT1A1
- A robust multi-objective optimization framework to capture both cellular and intercellular properties in cardiac cellular model tuning: Analyzing different regions of membrane resistance profile in parameter fitting
- Sea star wasting disease demography and etiology in the brooding sea star Leptasterias spp.
- Diagnostic plasma miRNA-profiles for ovarian cancer in patients with pelvic mass
- Genetic diversity and drug resistance of HIV-1 among infected pregnant women newly diagnosed in Luanda, Angola
- I’ve been robbed! – Can changes in floral traits discourage bee pollination?
- Visualising statistical models using dynamic nomograms
- Assessing the capacity of Malawi’s district and central hospitals to manage traumatic diaphyseal femoral fractures in adults
- Diagnostic performance of basal cortisol level at 0900-1300h in adrenal insufficiency
- The Mastery Rubric for Bioinformatics: A tool to support design and evaluation of career-spanning education and training
- Microdissection and whole chromosome painting confirm karyotype transformation in cryptic species of the Lariophagus distinguendus (Förster, 1841) complex (Hymenoptera: Pteromalidae)
- Quality of Kangaroo Mother Care services in Ethiopia: Implications for policy and practice
- Gemcitabine potentiates the anti-tumour effect of radiation on medullary thyroid cancer
- iTRAQ-based high-throughput proteomics analysis reveals alterations of plasma proteins in patients infected with human bocavirus
- The detection of a non-anemophilous plant species using airborne eDNA
- Perception and control of low cable operation forces in voluntary closing body-powered upper-limb prostheses
- Neoadjuvant chemotherapy plus surgery versus concurrent chemoradiotherapy in stage IB2-IIB cervical cancer: A systematic review and meta-analysis
- Randomized methods to characterize large-scale vortical flow networks
- Disentangling the coexistence strategies of mud-daubing wasp species through trophic analysis in oases of Baja California peninsula
- Front-of-pack nutritional labels: Understanding by low- and middle-income Mexican consumers
- Distress in patients with end-stage renal disease: Staff perceptions of barriers to the identification of mild-moderate distress and the provision of emotional support
- Pathways to antibiotics in Bangladesh: A qualitative study investigating how and when households access medicine including antibiotics for humans or animals when they are ill
- DOC export is exceeded by C fixation in May Creek: A late-successional watershed of the Copper River Basin, Alaska
- Behavioral observation of prosocial behavior and social initiative is related to preschoolers’ psychopathological symptoms
- Evaluating the impact of citations of articles based on knowledge flow patterns hidden in the citations
- Correction: Economic sanctions and academia: Overlooked impact and long-term consequences
- Correction: A novel association between relaxin receptor polymorphism and hematopoietic stem cell yield after mobilization
- Expression of Concern: Cooperativity of Oncogenic K-Ras and Downregulated p16/INK4A in Human Pancreatic Tumorigenesis
- Price dispersion of generic medications
- Sex differences in body composition but not neuromuscular function following long-term, doxycycline-induced reduction in circulating levels of myostatin in mice
- The emotion regulation effect of cognitive control is related to depressive state through the mediation of rumination: An ERP study
- Comparison of SMS-EPI and 3D-EPI at 7T in an fMRI localizer study with matched spatiotemporal resolution and homogenized excitation profiles
- Left ventricular mass normalization for body size in children based on an allometrically adjusted ratio is as accurate as normalization based on the centile curves method
- Correction: Combining biophysical parameters, spectral indices and multivariate hyperspectral models for estimating yield and water productivity of spring wheat across different agronomic practices
- Correction: Flowers as viral hot spots: Honey bees (Apis mellifera) unevenly deposit viruses across plant species
- 'Small small quarrels bring about happiness or love in the relationships’: Exploring community perceptions and gendered norms contributing to male perpetrated intimate partner violence in the Central Region of Ghana
- The performance of practitioners conducting facial comparisons on images of children across age
- Increased amounts and stability of telomeric repeat-containing RNA (TERRA) following DNA damage induced by etoposide
- Patients with limitation or withdrawal of life supporting care admitted in a medico-surgical intermediate care unit: Prevalence, description and outcome over a six-month period
- Correction: Diverse radiofrequency sensitivity and radiofrequency effects of mobile or cordless phone near fields exposure in Drosophila melanogaster
- Predicting the performance of TV series through textual and network analysis: The case of Big Bang Theory
- Risk of temperature, humidity and concentrations of air pollutants on the hospitalization of AECOPD
- Mixed methods grant applications in the health sciences: An analysis of reviewer comments
- Renal abnormalities among children with sickle cell conditions in highly resource-limited setting in Ghana
- Size matters: How reaching and vergence movements are influenced by the familiar size of stereoscopically presented objects
- Willingness to receive institutional and community-based eldercare among the rural elderly in China
- An improved deep learning method for predicting DNA-binding proteins based on contextual features in amino acid sequences
- Beyond executive functions, creativity skills benefit academic outcomes: Insights from Montessori education
- A LAMP assay for the rapid and robust assessment of Wolbachia infection in Aedes aegypti under field and laboratory conditions
- Nonarteritic anterior ischemic optic neuropathy is associated with cerebral small vessel disease
- Fiber-tract localized diffusion coefficients highlight patterns of white matter disruption induced by proximity to glioma
- The fight against polio through the NO-DO newsreels during the Francoism period in Spain
- Ocean sound levels in the northeast Pacific recorded from an autonomous underwater glider
- Cost-consequence analysis of influenza vaccination among the staff of a large teaching hospital in Rome, Italy: A pilot study
- The relationship among the progression of inflammation in umbilical cord, fetal inflammatory response, early-onset neonatal sepsis, and chorioamnionitis
- How medical professional students view older people with dementia: Implications for education and practice
- An enhanced nonparametric EWMA sign control chart using sequential mechanism
- Land use change, carbon stocks and tree species diversity in green spaces of a secondary city in Myanmar, Pyin Oo Lwin
- Is there a difference in women’s experiences of care with medication vs. manual vacuum aspiration abortions? Determinants of person-centered care for abortion services
- Maternal complications in pregnancy and childbirth for women with epilepsy: Time trends in a nationwide cohort
- Adsorption of oxytetracycline on kaolinite
- Interdisciplinary stratified care for low back pain: A qualitative study on the acceptability, potential facilitators and barriers to implementation
- The role of resource transfer in positive, non-additive litter decomposition
- The impact of language on the interpretation of resuscitation clinical care plans by doctors. A mixed methods study
- Quantum dots reveal heterogeneous membrane diffusivity and dynamic surface density polarization of dopamine transporter
- Genomic analysis of Shiga toxin-producing Escherichia coli from patients and asymptomatic food handlers in Japan
- The heavy metals lead and cadmium are cytotoxic to human bone osteoblasts via induction of redox stress
- Anatomical, taxonomic, and phylogenetic reappraisal of a poorly known ghost knifefish, Tembeassu marauna (Ostariophysi: Gymnotiformes), using X-ray microcomputed tomography
- Matrix-assisted laser desorption/ionization time of flight mass spectrometry identification of Vibrio (Listonella) anguillarum isolated from sea bass and sea bream
- Recommendations of older adults on how to use the PROM ‘TOPICS-MDS’ in healthcare conversations: A Delphi study
- The winner takes it all—Competitiveness of single nodes in globalized supply networks
- Hamsters in the city: A study on the behaviour of a population of common hamsters (Cricetus cricetus) in urban environment
- Correction: Liquid biopsies for omics-based analysis in sentinel mussels
- Size matters! Association between journal size and longitudinal variability of the Journal Impact Factor
- Drug resistance and epidemiology characteristics of multidrug-resistant tuberculosis patients in 17 provinces of China
- A model-based framework for chronic hepatitis C prevalence estimation
- Adding rewards to regulation: The impacts of watershed conservation on land cover and household wellbeing in Moyobamba, Peru
- Clinical determinants of social media use in individuals with schizophrenia
- Arsenic and nutrient absorption characteristics and antioxidant response in different leaves of two ryegrass (Lolium perenne) species under arsenic stress
- An evolution of socioeconomic related inequality in teenage pregnancy and childbearing in Malawi
- A single plasmid based CRISPR interference in Synechocystis 6803 – A proof of concept
- Structural vulnerability to narcotics-driven firearm violence: An ethnographic and epidemiological study of Philadelphia’s Puerto Rican inner-city
- Temporal trends in intracerebral hemorrhage: Evidence from the Austrian Stroke Unit Registry
- Prevalence and risk factors for multi-drug resistant Escherichia coli among poultry workers in the Federal Capital Territory, Abuja, Nigeria
- Prediction of disease-related metabolites using bi-random walks
- Clinical use, efficacy, and durability of maraviroc for antiretroviral therapy in routine care: A European survey
- Biomarker discovery in inflammatory bowel diseases using network-based feature selection
- The Cinderella Complex: Word embeddings reveal gender stereotypes in movies and books
- Exoproteome profiling of Trypanosoma cruzi during amastigogenesis early stages
- Reproducible phenotype alteration due to prolonged cooling of the pupae of Polyommatus icarus butterflies
- Nutritional treatment with an immune-modulating enteral formula alleviates 5-fluorouracil-induced adverse effects in rats
- Pharmacy-based predictors of non-adherence, non-persistence and reinitiation of antihypertensive drugs among patients on oral diabetes drugs in the Netherlands
- Systematic review of the accuracy of plasma preparation tubes for HIV viral load testing
- Circadian clock regulates the shape and content of dendritic spines in mouse barrel cortex
- “Anybody can make kids; it takes a real man to look after your kids”: Aboriginal men’s discourse on parenting
- Correction: A 1D computer model of the arterial circulation in horses: An important resource for studying global interactions between heart and vessels under normal and pathological conditions
- Maternal interpregnancy weight change and premature birth: Findings from an English population-based cohort study
- Correction: Identifying performance benchmarks and determinants for reproductive performance and calf survival using a longitudinal field study of cow-calf herds in western Canada
- Prognostic value of the model for end-stage liver disease excluding INR score (MELD-XI) in patients with adult congenital heart disease
- Treatment of Urethral Pain Syndrome (UPS) in Sweden
- Migration and political polarization in the U.S.: An analysis of the county-level migration network
- Epidemiology and complications of late-onset sepsis: an Italian area-based study
- The relationship between women’s experience of intimate partner violence and other socio-demographic factors, and under-5 children’s health in South Africa
- Association between trunk and gluteus muscle size and long jump performance
- Multimorbidity and complex multimorbidity in Brazilian rural workers
- Correction: Interspecific Phylogenic Relationships within Genus Melilotus Based on Nuclear and Chloroplast DNA
- Insulin-like growth factor (IGF)-II- mediated fibrosis in pathogenic lung conditions
- Wolf diet and prey selection in the South-Eastern Carpathian Mountains, Romania
- In vitro activity of aryl-thiazole derivatives against Schistosoma mansoni schistosomula and adult worms
- Sample size issues in multilevel logistic regression models
- Seed germination ecology of Ageratum houstonianum: A major invasive weed in Nepal
- Experiences of lifestyle change among women with gestational diabetes mellitus (GDM): A behavioural diagnosis using the COM-B model in a low-income setting
- Pharmacologic management of HCV treatment in patients with HCV monoinfection vs. HIV/HCV coinfection: Does coinfection really matter?
- The association between cigarette smoking and serum thyroid stimulating hormone, thyroid peroxidase antibodies and thyroglobulin antibodies levels in Chinese residents: A cross-sectional study in 10 cities
- Mouse movement measures enhance the stop-signal task in adult ADHD assessment
- Ecosystem functioning in urban grasslands: The role of biodiversity, plant invasions and urbanization
- Correction: KETOS: Clinical decision support and machine learning as a service – A training and deployment platform based on Docker, OMOP-CDM, and FHIR Web Services
- Does craniofacial morphology affect third molars impaction? Results from a population-based study in northeastern Germany
- Hyperconnectivity during screen-based stories listening is associated with lower narrative comprehension in preschool children exposed to screens vs dialogic reading: An EEG study
- Weight loss is associated with improved quality of life among rural women completers of a web-based lifestyle intervention
- Long-term high-grain diet altered the ruminal pH, fermentation, and composition and functions of the rumen bacterial community, leading to enhanced lactic acid production in Japanese Black beef cattle during fattening
- Beyond detoxification: Pleiotropic functions of multiple glutathione S-transferase isoforms protect mice against a toxic electrophile
- Golgi reassembly and stacking protein 65 downregulation is required for the anti-cancer effect of dihydromyricetin on human ovarian cancer cells
- SSR marker development in Clerodendrum trichotomum using transcriptome sequencing
- Risk factors for the carriage of Streptococcus infantarius subspecies infantarius isolated from African fermented dairy products
- Development of an intervention tool for precision oral self-care: Personalized and evidence-based practice for patients with periodontal disease
- Personal values in adolescence and psychological distress in adults: A cross-sectional study based on a retrospective recall
- Overactive bladder and bladder pain syndrome/interstitial cystitis in primary Sjögren’s syndrome patients: A nationwide population-based study
- Clinical utility of combined preimplantation genetic testing methods in couples at risk of passing on beta thalassemia/hemoglobin E disease: A retrospective review from a single center
- Hip stress distribution - Predictor of dislocation in hip arthroplasties. A retrospective study of 149 arthroplasties
- Mortality, morbidity, and cardiac surgery in Injection Drug Use (IDU)-associated versus non-IDU infective endocarditis: The need to expand substance use disorder treatment and harm reduction services
- Pup mortality in New Zealand sea lions (Phocarctos hookeri) at Enderby Island, Auckland Islands, 2013-18
- In vitro endothelial cell migration from limbal edge-modified Quarter-DMEK grafts
- Liquid Chromatography/Mass Spectrometry based serum metabolomics study on recurrent abortion women with antiphospholipid syndrome
- Gut carriage of antimicrobial resistance genes among young children in urban Maputo, Mozambique: Associations with enteric pathogen carriage and environmental risk factors
- Prepubertal nutrition alters Leydig cell functional capacity and timing of puberty
- Reliability of the Swedish version of the Evidence-Based Practice Attitude Scale assessing physiotherapist’s attitudes to implementation of evidence-based practice
- Mitochondrial alarmins are tissue mediators of ventilator-induced lung injury and ARDS
- Complete Chloroplast Genomes of Vachellia nilotica and Senegalia senegal: Comparative Genomics and Phylogenomic Placement in a New Generic System
- Retraction: Over-Expression of Superoxide Dismutase Ameliorates Cr(VI) Induced Adverse Effects via Modulating Cellular Immune System of Drosophila melanogaster
- Effect of pre-season training phase on anthropometric, hormonal and fitness parameters in young soccer players
- Exosomes from conditioned media of bone marrow-derived mesenchymal stem cells promote bone regeneration by enhancing angiogenesis
- Outcome of patients with heart failure after transcatheter aortic valve implantation
- Fatty acid profile of Romanian’s common bean (Phaseolus vulgaris L.) lipid fractions and their complexation ability by β-cyclodextrin
- Appropriate empirical antibiotic therapy and mortality: Conflicting data explained by residual confounding
- Treatment of corneal endothelial damage in a rabbit model with a bioengineered graft using human decellularized corneal lamina and cultured human corneal endothelium
- Telbivudine on IgG-associated hypergammaglobulinemia and TGF-β1 hyperactivity in hepatitis B virus-related liver cirrhosis
- Correction: Axial variation of deoxyhemoglobin density as a source of the low-frequency time lag structure in blood oxygenation level-dependent signals
- Correction: Mobile health-based physical activity intervention for individuals with spinal cord injury in the community: A pilot study
- Retraction: Placental expression of CD100, CD72 and CD45 is dysregulated in human miscarriage
- Correction: Use of IoT sensing and occupant surveys for determining the resilience of buildings to forest fire generated PM2.5
- Correction: The modulation of facial mimicry by attachment tendencies and their underlying affiliation motives in 3-year-olds: An EMG study
- Correction: Cognitive impairment in multiple sclerosis: An exploratory analysis of environmental and lifestyle risk factors
- Discovering novel disease comorbidities using electronic medical records
- Glutathione contributes to efficient post-Golgi trafficking of incoming HPV16 genome
- Epidemiology and antimicrobial resistance of methicillin-resistant Staphylococcus aureus isolates colonizing pigs with different exposure to antibiotics
- Social information use in adolescents: The impact of adults, peers and household composition
- Public practices on antibiotic use: A cross-sectional study among Qatar University students and their family members
- Effects of Topper Training on psychosocial problems, self-esteem, and peer victimisation in Dutch children: A randomised trial
- Comparative studies of two generations of NanoString nCounter System
- General practitioners’ perceptions of delayed antibiotic prescription for respiratory tract infections: A phenomenographic study
- Can altered magnetic field affect the foraging behaviour of ants?
- Parasitic infections and medical expenses according to Health Insurance Review Assessment claims data in South Korea, 2011–2018
- A prospective observational study of on-treatment plasma homocysteine levels as a biomarker of toxicity, depression and vitamin supplementation lead-in time pre pemetrexed, in patients with non-small cell lung cancer and malignant mesothelioma
- A strategy to identify protein-N-myristoylation-dependent phosphorylation reactions of cellular proteins by using Phos-tag SDS-PAGE
- Expression profile of sonic hedgehog signaling-related molecules in basal cell carcinoma
- Seasonal alternation of the ontogenetic development of the moon jellyfish Aurelia coerulea in Maizuru Bay, Japan
- Reliability of measurement of active trunk movement in wheelchair basketball players
- Chinese SLE Treatment and Research group (CSTAR) registry: Clinical significance of thrombocytopenia in Chinese patients with systemic lupus erythematosus
- Does source credibility matter for point-of-decision prompts? A quasi-experimental field study to increase stair use
- Male-pattern baldness and incident coronary heart disease and risk factors in the Heinz Nixdorf Recall Study
- Quality and utilization patterns of maternity waiting homes at referral facilities in rural Zambia: A mixed-methods multiple case analysis of intervention and standard of care sites
- Determining an optimal pool size for testing beef herds for Johne’s disease in Australia
- Correction: Change in larval fish assemblage in a USA east coast estuary estimated from twenty-six years of fixed weekly sampling
- APOE-knockout in rabbits causes loss of cells in nucleus pulposus and enhances the levels of inflammatory catabolic cytokines damaging the intervertebral disc matrix
- Testing Species Assignments in Extant Terebratulide Brachiopods: A Three-dimensional Geometric Morphometric Analysis of Long-Looped Brachidia
- A daily diary study on maladaptive daydreaming, mind wandering, and sleep disturbances: Examining within-person and between-persons relations
- Improved chemotherapy modeling with RAG-based immune deficient mice
- Effect of tracheal antimicrobial peptide on the development of Mannheimia haemolytica pneumonia in cattle
- The internal realities of individuals with type 2 diabetes – a functional framework of self-management practices via Grounded Theory approach
- Role of platelet parameters in early detection and prediction of severity of preeclampsia: A comparative cross-sectional study at Ayder comprehensive specialized and Mekelle general hospitals, Mekelle, Tigray, Ethiopia
- eIF4E and 4EBP1 are prognostic markers of head and neck squamous cell carcinoma recurrence after definitive surgery and adjuvant radiotherapy
- Smoking and other determinants of bone turnover
- Oxygen delivery, oxygen consumption and decreased kidney function after cardiopulmonary bypass
- School engagement of children in early grades: Psychometric, and gender comparisons
- Correction: A review of the elusive bicolored iris Snouted Treefrogs (Anura: Hylidae:Scinax uruguayus group)
- Perceived attractiveness of Czech faces across 10 cultures: Associations with sexual shape dimorphism, averageness, fluctuating asymmetry, and eye color
- Discovery of stable and prognostic CT-based radiomic features independent of contrast administration and dimensionality in oesophageal cancer
- Correction: Population-based dementia prediction model using Korean public health examination data: A cohort study
- Location, location, location: Close ties among older continuing care retirement community residents
- Correction: ISED: Constructing a high-resolution elevation road dataset from massive, low-quality in-situ observations derived from geosocial fitness tracking data
- Correction: Use of validated objective methods of locomotion characteristics and weight distribution for evaluating the efficacy of ketoprofen for alleviating pain in cows with limb pathologies
- Monitoring fine root growth to identify optimal fertilization timing in a forest plantation: A case study in Northeast Vietnam
- Metabolic costs of spontaneous swimming in Sprattus sprattus L., at different water temperatures
- Enterovirus 71 vaccine acceptance among parents of children < 5 years old and their knowledge of hand, foot and mouth disease, Chongqing, China, 2017
- Correction: Transcriptome profiling of mouse brain and lung under Dip2a regulation using RNA-sequencing
- Genetic diversity and antiretroviral resistance-associated mutation profile of treated and naive HIV-1 infected patients from the Northwest and Southwest regions of Cameroon
- Maximum parsimony interpretation of chromatin capture experiments
- Multiple innate antibacterial immune defense elements are correlated in diverse ungulate species
- Incidence and characteristics of ventricular tachycardia in patients after percutaneous coronary revascularization of chronic total occlusions
- Estimating measures of latent variables from m-alternative forced choice responses
- Clade F AAVHSCs cross the blood brain barrier and transduce the central nervous system in addition to peripheral tissues following intravenous administration in nonhuman primates
- First evidence of hepatitis E virus infection in a small mammal (yellow-necked mouse) from Croatia
- The inhibitory effects of polypyrrole on the biofilm formation of Streptococcus mutans
- Self-reported adverse drug effects and associated factors among H. pylori infected patients on standard triple therapy: Prospective follow up study
- Upregulation of ERK phosphorylation in rat dorsal root ganglion neurons contributes to oxaliplatin-induced chronic neuropathic pain
- Characterization of the relationship between neutron production and thermal load on a target material in an accelerator-based boron neutron capture therapy system employing a solid-state Li target
- Remote heart rate monitoring - Assessment of the Facereader rPPg by Noldus
- Seroprevalence of rubella virus antibodies among pregnant women in the Center and South-West regions of Cameroon
- Effectiveness of steam sterilization of reusable medical devices in primary and secondary care public hospitals in Nepal and factors associated with ineffective sterilization: A nation-wide cross-sectional study
- Relevance of HTLV-1 proviral load in asymptomatic and symptomatic patients living in endemic and non-endemic areas of Argentina
- Ritualized aggressive behavior reveals distinct social structures in native and introduced range tawny crazy ants
- The value of kinetic glomerular filtration rate estimation on medication dosing in acute kidney injury
- Screening and characterization of long noncoding RNAs involved in the albinism of Ananas comosus var. bracteatus leaves
- Visual attention to emotional faces in adolescents with social anxiety disorder receiving cognitive behavioral therapy
- A Q fever outbreak associated to courier transport of pets
- Antibodies against measles and rubella virus among different age groups in Thailand: A population-based serological survey
- Molecular diet analysis of Anguilliformes leptocephalus larvae collected in the western North Pacific
- Correction: The relationship between context, structure, and processes with outcomes of 6 regional diabetes networks in Europe
- Correction: The C-reactive protein/albumin ratio as an independent predictor of mortality in patients with severe sepsis or septic shock treated with early goal-directed therapy
- Interleukin 21 (IL-21) regulates chronic allograft vasculopathy (CAV) in murine heart allograft rejection
- Semantic computational analysis of anticoagulation use in atrial fibrillation from real world data
- The implementation of HTA in medicine pricing and reimbursement policies in Indonesia: Insights from multiple stakeholders
- International experiences during United States ophthalmology residency training: Current structure of international experiences and perspectives of faculty mentors at United States training institutions
- Questionable utility of digoxin in left-ventricular assist device recipients: A multicenter, retrospective analysis
- Genotyping and outcomes of presumptive second line ART failure cases switched to third line or maintained on second line ART in Mumbai, India
- A mathematical model of honey bee colony dynamics to predict the effect of pollen on colony failure
- Airway microbiome composition correlates with lung function and arterial stiffness in an age-dependent manner
- An odorant receptor from Anopheles gambiae that demonstrates enantioselectivity to the plant volatile, linalool
- Factors associated with full immunization of children 12–23 months of age in Ethiopia: A multilevel analysis using 2016 Ethiopia Demographic and Health Survey
- Additional evidence that the rat renal interstitium contracts in vivo
- Factors affecting acceptance of at-birth point of care HIV testing among providers and parents in Kenya: A qualitative study
- Removal efficiency of central vacuum system and protective masks to suspended particles from dental treatment
- Psychological well-being and distress in patients with generalized anxiety disorder: The roles of positive and negative functioning
- Conventional rotator cuff versus all-suture anchors—A biomechanical study focusing on the insertion angle in an unlimited cyclic model
- Are viral-infections associated with Ménière’s Disease? A systematic review and meta-analysis of molecular-markers of viral-infection in case-controlled observational studies of MD
- An evaluation of genetic causes and environmental risks for bilateral optic atrophy
- Comparative vector competence of the Afrotropical soft tick Ornithodoros moubata and Palearctic species, O. erraticus and O. verrucosus, for African swine fever virus strains circulating in Eurasia
- Effects of the solubility of yeast cell wall preparations on their potential prebiotic properties in dogs
- Carbogen gas-challenge BOLD fMRI in assessment of liver hypoxia after portal microcapsules implantation
- Socioeconomic determinants of cancer screening utilisation in Latin America: A systematic review
- Development of an easy-to-use questionnaire assessing critical care nursing competence in Japan: A cross-sectional study
- Towards successful business process improvement – An extension of change acceleration process model
- Correction: Dietary polyphenols as a safe and novel intervention for modulating pain associated with intervertebral disc degeneration in an in-vivo rat model
- Correction: Phylogenetic analysis of hepatitis C virus among HIV/ HCV co-infected patients in Nigeria
- Correction: Relationship between self-disclosure to first acquaintances and subjective well-being in people with schizophrenia spectrum disorders living in the community
- Impact of ATM rs1801516 on late skin reactions of radiotherapy for breast cancer: Evidences from a cohort study and a trial sequential meta-analysis
- Involvement of human and canine MRP1 and MRP4 in benzylpenicillin transport
- Soil organic matter rather than ectomycorrhizal diversity is related to urban tree health
- Clinical risk assessment in early pregnancy for preeclampsia in nulliparous women: A population based cohort study
- The relation between circulating levels of vitamin D and parathyroid hormone in children and adolescents with overweight or obesity: Quest for a threshold
- Behavioural evidence for segments as subordinate units in Chinese spoken word production: The form-preparation paradigm revisited
- Correction: Measuring the impact of an interdisciplinary learning project on nursing, architecture and landscape design students’ empathy
- Analysis of the characteristics of chemotherapy-resistant renal cell carcinomas based on global transcriptional analysis of their tissues and cell lines
- The characteristics and treatment patterns of patients with Parkinson’s disease in the United States and United Kingdom: A retrospective cohort study
- Sex differences in youth elite swimming
- Unconventional SCCmec types and low prevalence of the Panton-Valentine Leukocidin exotoxin in South African blood culture Staphylococcus aureus surveillance isolates, 2013-2016
- Prosocial perceptions of taxation predict support for taxes
- Correction: Clonality analysis of pulmonary tumors by genome-wide copy number profiling
- Improved oxygenation following methylprednisolone therapy and survival in paediatric acute respiratory distress syndrome
- Normative values for relative schoolbag weight in primary school children aged 6-14 from Czech Republic: A pilot study
- Correction: Intensive longitudinal modelling predicts diurnal activity of salivary alpha-amylase
- Correction: SNV discovery and functional candidate gene identification for milk composition based on whole genome resequencing of Holstein bulls with extremely high and low breeding values
- Monoclonal antibody anti-PBP2a protects mice against MRSA (methicillin-resistant Staphylococcus aureus) infections
- Diurnal variations of amplitude of accommodation in different age groups
- HHIP overexpression inhibits the proliferation, migration and invasion of non-small cell lung cancer
- Infusion of HIV-1 Nef-expressing astrocytes into the rat hippocampus induces enteropathy and interstitial pneumonitis and increases blood–brain-barrier permeability
- Correlation analysis of cold-related gene expression with physiological and biochemical indicators under cold stress in oil palm
- Student engagement and wellbeing over time at a higher education institution
- Gender-based differences in platelet function and platelet reactivity to P2Y12 inhibitors
- Influence of season and social context on male giant panda (Ailuropoda melanoleuca) vocal behaviour
- Development of an intravaginal ring for the topical delivery of Aurora kinase A inhibitor, MLN8237
- Differential phosphorylation determines the repressor and activator potencies of GLI1 proteins and their efficiency in modulating the HPV life cycle
- Polymorphisms of FDPS, LRP5, SOST and VKORC1 genes and their relation with osteoporosis in postmenopausal Romanian women
- Depression increases the risk of rotator cuff tear and rotator cuff repair surgery: A nationwide population-based study
- Interleukin-38 interacts with destrin/actin-depolymerizing factor in human keratinocytes
- Correction: Fast, quantitative, murine cardiac 19F MRI/MRS of PFCE-labeled progenitor stem cells and macrophages at 9.4T
- Persistent post-discharge opioid prescribing after traumatic brain injury requiring intensive care unit admission: A cross-sectional study with longitudinal outcome
- Genome-wide histone modification profiling of inner cell mass and trophectoderm of bovine blastocysts by RAT-ChIP
- Aerobic exercise increases post-exercise exogenous protein oxidation in healthy young males
- Selection for tandem stop codons in ciliate species with reassigned stop codons
- Research ethics in inter- and multi-disciplinary teams: Differences in disciplinary interpretations
- Correction: Analyzing data from the digital healthcare exchange platform for surveillance of antibiotic prescriptions in primary care in urban Kenya: A mixed-methods study
- Correction: People making deontological judgments in the Trapdoor dilemma are perceived to be more prosocial in economic games than they actually are
- LFRET, a novel rapid assay for anti-tissue transglutaminase antibody detection
- Effects of isotemporal substitution of sedentary behavior with light-intensity or moderate-to-vigorous physical activity on cardiometabolic markers in male adolescents
- Topical estrogen application to wounds promotes delayed cutaneous wound healing in 80-week-old female mice
- Correction: An international randomised placebo-controlled trial of a four-component combination pill (“polypill”) in people with raised cardiovascular risk
- Correction: Evaluation of lung toxicity risk with computed tomography ventilation image for thoracic cancer patients
- Retraction: Pathological Roles of Interleukin-22 in the Development of Recurrent Hepatitis C after Liver Transplantation
- Correction: Elevational Distribution and Ecology of Small Mammals on Tanzania's Second Highest Mountain
- Correction: Decreased breast cancer-specific mortality risk in patients with a history of thyroid cancer
- Correction: Fecal microbiota dysbiosis in macaques and humans within a shared environment
- Correction: The center of pressure and ankle muscle co-contraction in response to anterior-posterior perturbations
- PLOS One
- Archív čísel
- Aktuálne číslo
- Informácie o časopise
Najčítanejšie v tomto čísle- A daily diary study on maladaptive daydreaming, mind wandering, and sleep disturbances: Examining within-person and between-persons relations
- Pathways to conspiracy: The social and linguistic precursors of involvement in Reddit’s conspiracy theory forum
- A 3’ UTR SNP rs885863, a cis-eQTL for the circadian gene VIPR2 and lincRNA 689, is associated with opioid addiction
- A substitution mutation in a conserved domain of mammalian acetate-dependent acetyl CoA synthetase 2 results in destabilized protein and impaired HIF-2 signaling
Prihlásenie#ADS_BOTTOM_SCRIPTS#Zabudnuté hesloZadajte e-mailovú adresu, s ktorou ste vytvárali účet. Budú Vám na ňu zasielané informácie k nastaveniu nového hesla.
- Časopisy