-
Články
- Časopisy
- Kurzy
- Témy
- Kongresy
- Videa
- Podcasty
- Kariéra
Clade F AAVHSCs cross the blood brain barrier and transduce the central nervous system in addition to peripheral tissues following intravenous administration in nonhuman primates
Authors: Jeff L. Ellsworth aff001; Jacinthe Gingras aff001; Laura J. Smith aff001; Hillard Rubin aff001; Tania A. Seabrook aff001; Kruti Patel aff001; Nicole Zapata aff001; Kevin Olivieri aff001; Michael O’Callaghan aff001; Elizabeth Chlipala aff002; Pablo Morales aff003; Albert Seymour aff001
Authors place of work: Homology Medicines, Inc., Bedford, Massachusetts, United States of America aff001; Premier Laboratory, LLC., Boulder, Colorado, United States of America aff002; Mannheimer Foundation, Inc., Homestead, Florida, United States of America aff003
Published in the journal: PLoS ONE 14(11)
Category: Research Article
doi: https://doi.org/10.1371/journal.pone.0225582Summary
The biodistribution of AAVHSC7, AAVHSC15, and AAVHSC17 following systemic delivery was assessed in cynomolgus macaques (Macaca fascicularis). Animals received a single intravenous (IV) injection of a self-complementary AAVHSC-enhanced green fluorescent protein (eGFP) vector and tissues were harvested at two weeks post-dose for anti-eGFP immunohistochemistry and vector genome analyses. IV delivery of AAVHSC vectors produced widespread distribution of eGFP staining in glial cells throughout the central nervous system, with the highest levels seen in the pons and lateral geniculate nuclei (LGN). eGFP-positive neurons were also observed throughout the central and peripheral nervous systems for all three AAVHSC vectors including brain, spinal cord, and dorsal root ganglia (DRG) with staining evident in neuronal cell bodies, axons and dendritic arborizations. Co-labeling of sections from brain, spinal cord, and DRG with anti-eGFP antibodies and cell-specific markers confirmed eGFP-staining in neurons and glia, including protoplasmic and fibrous astrocytes and oligodendrocytes. For all capsids tested, 50 to 70% of glial cells (S100-β+) and on average 8% of neurons (NeuroTrace+) in the LGN were positive for eGFP expression. In the DRG, 45 to 62% of neurons and 8 to 12% of satellite cells were eGFP-positive for the capsids tested. eGFP staining was also observed in peripheral tissues with abundant staining in hepatocytes, skeletal - and cardio-myocytes and in acinar cells of the pancreas. Biodistribution of AAVHSC vector genomes in the central and peripheral organs generally correlated with eGFP staining and were highest in the liver for all AAVHSC vectors tested. These data demonstrate that AAVHSCs have broad tissue tropism and cross the blood-nerve and blood-brain-barriers following systemic delivery in nonhuman primates, making them suitable gene editing or gene transfer vectors for therapeutic application in human genetic diseases.
Keywords:
Central nervous system – Neurons – Cell staining – Primates – Macaque – Cytoplasmic staining – Intravenous injections
Introduction
The introduction of adeno-associated viruses (AAVs) as vectors for transgene delivery has had a significant impact on clinical development of genetic therapies for a range of human diseases [1–8]. Driving the interest in using AAVs for gene therapy (GT) are several well-described attributes of this group of parvoviruses: their ability to transduce both dividing and non-dividing cells, their relatively low toxicity and immunogenicity and their wide tissue tropism. Improved manufacturing methods for scalable, high-yield production of recombinant AAVs and enhanced screening and isolation of AAV capsids with novel characteristics have further enabled development of AAVs for GT [9].
A group of fifteen AAVs isolated from normal human CD34+ hematopoietic stem cells, termed AAVHSCs, have been described[10]. More recently, we have shown that the AAVHSCs can mediate nuclease-free gene editing with high efficiencies [11] and can also be used for gene transfer using transgenes under the control of exogenous promoters [12, 13]. Analysis of the AAVHSC capsid sequences revealed that these AAVHSCs all fall within AAV Clade F [14]. A property of Clade F vectors is the ability to traverse the blood-brain-barrier (BBB) following intravascular administration, resulting in transduction of neurons and glia in neonatal and adult mice [15, 16], rats [17], cats [16] and in nonhuman primates [18, 19]. These data suggested that systemic delivery of a BBB-penetrating AAV could be used to deliver therapeutic genes to the central nervous system (CNS). Extended to human patients with spinal muscular atrophy, systemic delivery of AAV9-SMN1 increased survival, improved motor milestone achievement and partially restored motor function [5]. These data led to the recent approval of Zolgensma® for pediatric patients with spinal muscular atrophy [20].
As we are developing the AAVHSCs for use as gene editing and gene therapy vectors for treatment of rare genetic diseases in humans, it was necessary to characterize their biodistribution in nonhuman primates. Cynomolgus macaques were used in the present work for their close phylogenetic relationship to humans and to avoid disparities in CNS biodistribution previously reported between mice and nonhuman primates [21]. Data gained from such studies provide not only the tissue and associated cell type tropism of the AAVHSCs but also inform selection of potential therapeutic indication(s) for these vectors.
To evaluate the ability of AAVHSCs in crossing the blood-nerve-barrier (BNB) and BBB after systemic delivery and assess their cellular tropism in the CNS and peripheral organs, AAVHSC7, AAVHSC15 and AAVHSC17 were studied in four to five month-old cynomolgus macaques, an age where the permeability of the BBB is considered mature [22, 23]. These vectors were chosen based on tissue tropism observed in mice where AAVHSC7, AAVHSC13, AAVHSC15 and AAVHSC17 showed extensive liver tropism and wide tissue distributions [24]. Only AAVHSC7, AAVHSC15 and AAVHSC17 were pursued in nonhuman primate studies due to AAVHSC13 and AAVHSC17 having the same amino acid sequence [10]. These three AAVHSC capsids showed high packaging efficiencies and could be produced in amounts sufficient for biodistribution studies in large animals facilitating their use in the present study in nonhuman primates. Each vector packaged a self-complementary (sc) eGFP reporter transgene driven by a ubiquitously-expressing promoter and was administered to cynomolgus macaques by a single IV infusion. Our data show a widespread rostro-caudal transduction gradient of neurons and glia within the CNS by the AAVHSCs including most regions of the brain and spinal cord. High-level transduction of the dorsal root ganglia (DRG) and other peripheral tissues was also observed with eGFP expression highest in liver for all three AAVHSCs tested. Extensive eGFP immunostaining was also observed in skeletal - and cardio-myocytes, pancreas, and in the kidneys.
Materials and methods
Animal care and use
Housing and all procedures were in accordance to the Institutional Animal Care and Use Committee at the Mannheimer Foundation (Homestead, FL). All breeding, housing, and procedures were performed on cynomolgus macaques (Macaca fascicularis) at the Mannheimer Foundation, Inc. under Protocol Number 2016–05. All procedures were performed under ketamine anesthesia and all efforts were made to minimize suffering. Social housing in large outdoor pens is the primary housing method for all colony animals. No animal is isolated in areas without other animals. Animals greater than 6 months of age may be temporarily housed in single cages for clinical reasons (treatments). Animal may also be housed in single cages when the IACUC approves it for research that provides adequate scientific justification. All animals that must be temporarily housed singly, are provided with visual, auditory, and olfactory contact with other animals. Further, connecting cages are used whenever possible to allow tactile contact or pair housing. All cages are equipped with mirrors to allow self-viewing and as an aid to view room activities. Positive human contact is also added as it has been shown to reduce abnormal behavior activities as well as anxiety and fear. Additional enrichment may be provided during single housing and may include the use of puzzle feeders and/or other feeding enrichments to insure/encourage species typical foraging activities.
All singly-housed animals are fed at least once daily in bowls or feed cups mounted on the individual cages. A small portion is offered to those cages where no food is present early in the morning–and/or those that will be cleaned later on that day. Group housed animals are fed daily using galvanized type or polypropylene feeders. Purina LabDiet products are used at the Mannheimer Foundation facilities (LabDiet 5049) Fruits, vegetables are other healthy food items approved by the attending veterinarian, are offered on a daily basis to both indoor and outdoor housed animals.
Anesthesia and analgesia guidelines are provided, based on current literature and veterinarian recommendations. Veterinarians are consulted by researchers about the selection and use of anesthetics/analgesics, as required by the Mannheimer Foundation IACUC, which follows a veterinary consultation process prior to the use of analgesics, anesthesia, sedation, tranquilization and euthanasia. The Mannheimer Foundation veterinary staff directly administer anesthetics, and provides post-operative care, including analgesia. Animal health records are closely monitored by the veterinary staff to verify that anesthetics and analgesics are being administered and properly recorded per protocol directions.
Euthanasia is always performed by overdose of barbiturates. Euthanasia procedures are performed by veterinarians (or veterinary assistants under supervision of veterinarians)–and according the 2013 AVMA Guidelines on Euthanasia. Any deviation from approved procedures requires scientific justification in the form of an IACUC-approved protocol. No animals are euthanized in rooms or areas where other animals are present. The Mannheimer Foundation Institutional Animal Care and Use Committee (IACUC) specifically approved this study.
AAVHSC vector production
All vectors were produced by triple transfection in HEK293 cells and purified through two rounds of CsCl density gradient ultracentrifugation at SABTech, Inc., (Philadelphia, PA). All AAVHSC vectors were formulated in PBS (180mM NaCl, 10mM sodium phosphate, pH7.3) with 0.001% Pluronic F68. Vector titers were determined by qPCR using primers and probes specific for eGFP.
IV delivery of scAAVHSC-CBA-eGFP in nonhuman primates
Sera from all animals were prescreened for anti-AAVHSC neutralizing antibodies using the Huh-7 cell-based assay [Horae Gene Therapy Center, University of Massachusetts (Worcester, MA)] over a range of serum dilutions from 1/10 to 1/1250. Only antibody negative animals were used in this work. Veterinary staff at the Mannheimer Foundation anesthetized each subject (young males, 4–5 months old) with an intramuscular injection of ketamine (10 mg/kg). Each animal was fitted with a saphenous vein catheter for IV injection of AAVHSCs. Blood samples were collected from the femoral vein for assessment of clinical chemistries, CBCs, and neutralizing antibodies at baseline. AAVHSCs were infused at doses of 1.0 x 1014 vg/kg for scAAVHSC17-CBA-eGFP (n = 2 animals) and 0.7 x 1014 vg/kg for scAAVHSC15-CBA-eGFP (n = 2 animals) and scAAVHSC7-CBA-eGFP (n = 1 animal) or an equivalent volume of vehicle alone (n = 1 animal) at 7–8 mL/kg through a saphenous vein catheter over 1.0 min using all-plastic syringes. Each animal was allowed to recover in a warmed incubator following injection and, when fully awake was returned to the cage with its mother. At two weeks post-dosing, all subjects were anesthetized with ketamine, heparinized (5,000 units, given 5–10 min prior to sacrifice) and euthanized with an overdose of IV sodium pentobarbital (80–100 mg/kg).
Perfusion and tissue processing
Immediately following euthanasia, each animal was trans-cardially perfused with 1.0L of phosphate-buffered saline followed by 1.0L of 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS), pH7.4 (Polyscientific R & D, Bay Shore, NY). Tissues were excised and were post-fixed in fresh 4% PFA in PBS, pH7.4 for 48-h at room temperature and were then transferred to PBS + 0.05% sodium azide (Teknova, Hollister, CA) and stored at 4° C.
Histology and microscopy
Non-CNS paraffin-embedded tissues (except dorsal root ganglia) were sectioned at 4–5 microns and were processed for eGFP immunohistochemistry (IHC) at Premier Laboratory (Boulder, CO). eGFP-positive cells were stained by IHC with a rabbit anti-eGFP polyclonal antibody (Abcam #ab290). Endogenous peroxidase was inhibited by incubation in 3% H2O2. An enzyme pretreatment of proteinase K was utilized, followed by a serum-free protein block. Primary antibody incubation for 30 minutes at room temperature, followed by an EnVision+ Rabbit HRP detection system. eGFP was visualized with an EnVision+Rabbit HRP kit using diaminobenzidine to stain for eGFP and hematoxylin as counterstain. The IHC slides were assessed according to the following methodology. Slides were viewed with a Nikon Eclipse 80i microscope with an attached Nikon DXM 1200C digital camera. For each IHC tissue the entire tissue was assessed, and then using Nikon Elements version 3.0 software, the approximate percentage of the tissue that was positive for the DAB signal was batched into 3 separate intensity grades: +1 (approx. 201–220 intensity signal in the software); +2 (approx. 151–200 intensity signal in the software); +3 (approx. 100–150 intensity signal in the software) A scoring example for eGFP staining in the liver is shown in S2 Fig.
CNS tissues (brains and spinal cords) and peripheral nervous system (PNS) tissues (DRG) were processed for eGFP IHC at NeuroScience Associates (Knoxville, TN). Tissues were treated with 20% glycerol and 2% dimethylsulfoxide to prevent freeze-artifacts and multiply embedded in a gelatin matrix using MultiBrain™ Technology (NeuroScience Associates). After curing, each block was rapidly frozen by immersion in isopentane chilled to -70°C with crushed dry ice and were mounted on a freezing stage of an AO 860 sliding microtome. The MultiBrain™ block was sectioned coronally at 40 μm. Approximately 1650 sections were taken per brain (macaque brains at this age are ~65 mm in length) with every 24th section stained with a 960 μm interval between stained sections. Both sagittal and longitudinal sections (40 μm) of spinal cords and 40 μm sections were taken of DRG. All sections cut (none were discarded) were collected sequentially into 24 containers which were filled with Antigen Preserve solution (50% PBS pH 7.0, 50% Ethylene glycol, 1% Polyvinyl Pyrrolidone). CNS tissue sections were stained free-floating. All incubation solutions from the blocking serum onward used Tris buffered saline (TBS) with Triton X-100 (TX) as the vehicle; all rinses were with TBS. After treatment with hydrogen peroxide and blocking serum, the sections were immunostained with a GFP Tag Antibody, ABfinity™ Rabbit Monoclonal (Thermo Fisher Scientific, catalog # G10362, RRID AB_2536526) at a 1 : 500 dilution overnight at room temperature. Vehicle solution contained Triton X-100 for permeabilization. Slides were rinsed and a biotinylated goat anti-rabbit HRP secondary antibody was applied and eGFP was visualized with diaminobenzidine and counterstained with thionine light. IHC images were acquired using Aperio-Imagescope (Leica Biosystems) and Huron Viewer (Huron Digital Pathology) softwares. All eGFP positive and negative control tissues showed the expected level of staining.
All CNS, PNS and non-CNS tissue slides were read and scored for eGFP in a blinded manner by board-certified veterinary pathologists at ToxPathSpecialists (Frederick, MD) and Charter Preclinical Services (Hudson, MA), respectively.
Immunofluorescence
A subset of brain, spinal cord, and DRG sections (40 μm) from the MultiBrain™ blocks were processed using immunofluorescence to co-label for eGFP and glial and/or neuronal specific markers. Free-floating sections from PFA perfused animals (see details above) were rinsed in TBS and subsequently blocked for 2.0h at room temperature with a buffer containing 5% normal donkey serum (Novus Bio catalog # NBP1-50088) and 0.25% Triton X-100 (ThermoFisher Scientific catalog # 85111) in TBS. Sections were incubated in primary antibodies diluted in blocking buffer overnight at 4°C. eGFP signal was boosted by using a chicken polyclonal anti-eGFP (Aves Labs catalog # GFP-1020 at 1 : 1,000). Glial cell types (astrocytes/oligodendrocytes/satellite cells) were detected using: rabbit polyclonal anti-ALDH1L1 (Neuromics catalog # RA22119 at 1 : 200); rabbit polyclonal anti-GFAP (Abcam catalog # ab16997 at 1 : 100); mouse monoclonal anti-S100 β-subunit (Sigma catalog # S2532 at 1 : 1,000); mouse monoclonal anti-MBP (BioLegend catalog # 808403 at 1 : 500). Neuronal cell types were detected using: rabbit monoclonal anti-NeuN (Abcam catalog # ab177487 at 1 : 300); mouse monoclonal anti-calbindin-D28K (Sigma catalog # C9848 at 1 : 500); mouse monoclonal anti-neurofilament (SMI-32) (BioLegend catalog # 801701 at 1 : 500) or by doing a fluorescent Nissl post-staining (NeuroTrace™ 530/615; ThermoFisher catalog # N21482 at 1 : 200 for 20 mins). Sections used as negative controls to differentiate non-specific background signal from specific antibody signal were treated with isotype specific antibodies matching the concentration of the primary antibodies: chicken IgY (BioLegend catalog # 402101 or Abcam catalog # ab50579); mouse IgG (Invitrogen catalog # 31903 or Abcam catalog # ab37355); rabbit IgG (Abcam catalog # ab37415). Following washes in TBS, the sections were incubated in species-specific secondary antibodies conjugated to either Alexa 488 (Jackson Immuno catalog # 703-545-155), 555 (Invitrogen catalog # A31570 or A31572), or 647 (Invitrogen catalog # A31571 or A31573) diluted at 1 : 1,000 in block buffer for 2 hours at room temperature. Sections were mounted onto slides then treated with TrueBlack® (Biotium, catalog # 23007) diluted in 70% ethanol for 30 seconds to reduce autofluorescence. Slides were rinsed with TBS before mounted in ProLong™ Gold Antifade Mountant with DAPI (Invitrogen catalog # P36931). Fluorescent images were acquired using a Zeiss LSM 800 with Airyscan and ZEN Blue software (Zeiss).
The percentage of eGFP-positive cells per cell-type (neurons or glia) was determined in one CNS region (LGN) and one PNS region (DRG), for AAVHSC17 (n = 2 animals), AAVHSC15 (n = 2 animals), and AAVHSC7 (n = 1 animal). All sections used for quantification were acquired with fixed imaging parameters. For the eGFP signal, background was measured from IgY isotype control images and subtracted from the images for quantification. Total neuron or glial counts within a set region of interest were performed with the use of ImageJ or the ZEN Image Analysis module [Region of Interest (ROI) were 500 μm x 500 μm for LGN neuron counts; 200 μm x 200 μm for DRG neuron counts; and 100 μm x 100 μm for LGN and DRG glia counts)]. eGFP-positive cells within each population (neurons or glia) were manually counted. Data is represented as an average of 3 ROIs per image for each capsid with the exception of neuron counts for LGN which was from a single ROI.
Vector genome analysis in nonhuman primate tissues
All DNA was isolated from fixed tissue using the RecoverAll™ Total Nucleic Acid Isolation Kit for formalin - or paraformalin-fixed, paraffin-embedded (FFPE) (ThermoFisher) according to instructions. Paraffin-embedded tissues were deparafinized by xylene treatment followed by an ethanol wash prior to DNA extraction. Deparafinized tissues were protease digested in the provided digestion buffer and bound to a rapid glass-fiber filter, followed by an in-filter RNase treatment. DNA is eluted with 60 μl of 95°C molecular grade water. Vector genome copies per cell were determined by qPCR using TaqMan™ Universal PCR Master Mix (ThermoFisher) and eGFP and cyno ApoB specific primers and probes.
eGFP Probe: TACCTGAGCACCCAGTCCGCCCT;
eGFP Forward: CTGCTGCCCGACAACCA;
eGFP Reverse: GACCATGTGATCGCGCTTCT.
Cynomolgus macaque ApoB Probe: CGAGAATCACCCTGCCAGACTTCCAT; Cynomolgus macaque ApoB Forward: TGAAGGTGGAGGACATTCCTCTA; Cynomolgus macaque ApoB Reverse: CTGGAATTGCGATTTCTGGTAA.
Results
IV delivery of scAAVHSC-CBA-eGFP results in widespread transduction of the CNS in nonhuman primates
To evaluate biodistribution of AAVHSCs after systemic delivery, self-complementary (sc) AAVHSC7, AAVHSC15 and AAVHSC17 each packaging an eGFP reporter transgene driven by the ubiquitously-expressing chicken beta actin (CBA) promoter were prepared. These capsids were chosen for this work based on biodistribution studies in mice [24]. All animals were negative for serum anti-AAVHSC neutralizing antibodies over a range of sera dilutions. The doses used were the highest possible based on the vector titer, animal body weights at the time of infusion and the volume limits for IV infusion. Each animal received a single IV infusion of either vehicle-alone or vehicle with the indicated scAAVHSC-CBA-eGFP. Two weeks after dosing the animals were humanely euthanized and tissues were harvested for analyses of eGFP expression by IHC and distribution of eGFP vector genomes. Following treatment with scAAVHSC17-CBA-eGFP, eGFP IHC detection was characterized across the whole brain in one monkey to evaluate the coronal biodistribution of eGFP across both hemispheres. eGFP detection was observed throughout the brain in both white and grey matter regions including the cerebral cortex, caudate nuclei and putamen (Fig 1A and 1B). In this animal, detection of eGFP was bilateral in every region examined with high levels of eGFP detected in the pons, red nuclei, and LGN (Fig 1A). Expression in both treated-animals was predominately in glial cells, interpreted to be astrocytic in nature (Fig 1B inset) based on morphology and counterstain. Scattered eGFP-positive single isolated neuronal cell bodies were also seen across these regions (see black arrows in Fig 1B, inset). Astrocytes take on a “fuzzy” brown appearance in these images due to the abundance of highly branched cellular processes and thickness of the tissue sections. No eGFP was detected in animals injected with vehicle alone (Fig 1C). All subsequent IHC was performed on one hemisphere of the brain of each treated animal.
Fig. 1. eGFP detection within multiple brain regions of Cynomolgus macaques following IV delivery of scAAVHSC17-CBA-eGFP. (A and B) low power hindbrain and cortical/midbrain regions, respectively, of the two individual macaques (A: animal H16C32; B: animal 16C26) treated with IV scAAVHSC17-CBA-eGFP (1 x1014 vg/kg) on Day 0. (C): low power cortical/midbrain view of a macaque treated with IV vehicle alone (animal H16C14). Tissues were harvested two weeks post-dose and brains were sectioned and stained with an anti-eGFP antibody as described under Materials and methods. eGFP was visualized with diaminobenzidine staining (brown color). Location of the cortex, basal ganglia (caudate and putamen) pons, red nuclei and LGN and putamen are shown. Insets are higher magnification views of the boxed areas in each panel. Each bar represents 1000 μm or 50 μm in the insets. The most pronounced eGFP signal was in the region of the LGN (Fig 2) and pons (Fig 3) for animals treated with systemic scAAVHSC17-CBA-eGFP, scAAVHSC15-CBA-eGFP or scAAVHSC7-CBA-eGFP. The majority of eGFP-positive cells in these brain regions were glial (astrocytes) with occasional neuronal profiles. scAAVHSC7-CBA-eGFP appeared to show greater transduction of astrocytes and neurons within the pons and lateral geniculate nucleus in this animal compared with either scAAVHSC17-CBA-eGFP or scAAVHSC15-CBA-eGFP treated animals (Figs 2 and 3). eGFP-positive cells with astrocyte morphologies showed extensive staining within cell bodies and radial processes in the scAAVHSC7-CBA-eGFP-treated animal (Figs 2K and 3K, S1 Fig). Similarly, the cell bodies, axons and proximal dendritic trees of neurons showed intense eGFP staining in animals treated with scAAVHSC17-CBA-eGFP or scAAVHSC15-CBA-eGFP (Figs 2 and 3, S1 Fig). Within the Purkinje cell layer of the cerebellum, occasional intense eGFP stained Purkinje neuronal cell bodies, axons and corresponding dendritic arbor were observed (S1 Fig). A much larger number of eGFP-positive Bergmann glia cell bodies and radial branches extending through the molecular layer of the cerebellum were observed in animals treated with all three scAAVHSC-CBA-eGFP (S1 Fig for scAAVHSC15-CBA-eGFP). Of note, little or no eGFP staining was seen in endothelial cells of the brain vasculature in any brain region examined in any of the treated-animals (S2 Fig, images from a scAAVHSC17-CBA-eGFP-treated animal are shown). No eGFP positive cells were seen in any of these brain regions in animals treated with vehicle alone (Fig 1C; Fig 2J, Fig 2L, Fig 3J, and Fig 3L).
Fig. 2. Detection of eGFP expression with neurons and glia of the LGN of Cynomolgus macaques treated with IV scAAVHSC-CBA-eGFP. Fig. 3. Expression of eGFP within pontine neurons and glia of Cynomolgus macaques treated with an IV injection of scAAVHSC-CBA-eGFP. The distribution and extent of eGFP staining across the brain presented in a rostro-caudal manner. Corresponding eGFP-positive regions were scored in a blinded fashion. The evaluation was performed to determine 1) the most prominent eGFP-positive cerebral regions and 2) the corresponding percent of eGFP-positive cell type (neuron or glia)/structure in said regions. The grading scheme was designed to allow for the differentiation of subtle staining (<1% of the cell type/structure in a given defined anatomic region stained for eGFP) from areas with more pronounced staining. At the higher grades [4 (15–40% of the cell type/structure and 5 (>40% of the cell type/structure)] there is the possibility of overlap because the grades were estimated based on qualitative visual observation. Heat maps of these data show eGFP staining in glial profiles in virtually all brain regions scored for both animals treated with scAAVHSC17-CBA-eGFP (Fig 4A and 4B) with minimal amounts of eGFP-positive neurons throughout the brain (Fig 5A and 5B). Glial eGFP staining was highest in the frontal, parietal and temporal cortex, red nucleus, pons, LGN and the septal region with a similar distribution and intensity of staining observed in the two animals treated with scAAVHSC17-CBA-eGFP (Fig 4A and 4B). The distribution of eGFP-positive neurons was generally similar but much less pronounced to that of glial cell staining. A similar pattern of eGFP staining within glial cells was observed in the brain of animals treated with a single IV dose of scAAVHSC15-CBA-eGFP (Fig 6A and 6B). Treatment with scAAVHSC15-CBA-eGFP led to a somewhat higher level and distribution of eGFP-positive neuronal profiles in the brain regions analyzed herein compared to treatment with scAAVHSC17-CBA-eGFP (Fig 7A and 7B vs. Fig 5A and 5B).
Fig. 4. Heat maps of eGFP staining intensity within glia throughout the brain of Cynomolgus macaques treated with IV scAAVHSC17-CBA-eGFP. (A) Glial staining in animal H16C32. (B) glial staining in animal 16C26. All sections were scored in a blinded manner as described under Materials and methods. The percent of cell type stained per structure on each slide was grade 1: <1%, grade 2: 1–5%, grade 3: 5–15%, grade 4: 15–40%, and grade 5: >40%. Grey areas represent those areas where either no brain structure was present or no eGFP staining was seen. The numbers below each heat map represent the coronal brain section from most rostral (slide 1) to most caudal (slide 59). Fig. 5. Heat maps of eGFP staining intensity within neurons throughout the brain of Cynomolgus macaques treated with IV scAAVHSC17-CBA-eGFP. (A) Neuronal staining in animal H16C32. (B) Neuronal staining in animal 16C26. All sections were scored in a blinded manner as described under Materials and methods. The percent of cell type stained per structure on each slide was grade 1: <1%, grade 2: 1–5%, grade 3: 5–15%, grade 4: 15–40%, and grade 5: >40%. Grey areas represent those areas where either no brain structure was present or no eGFP staining was seen. The numbers below each heat map represent the coronal brain section from most rostral (slide 1) to most caudal (slide 59). Fig. 6. Heat maps of eGFP staining intensity within glia throughout the brain of Cynomolgus macaques treated with IV scAAVHSC15-CBA-eGFP. (A) Glial eGFP staining in animal 16C33. (B) Glial staining in animal 16C45. All sections were scored in a blinded manner as described under Materials and methods. The percent of cell type stained per structure on each slide was grade 1: <1%, grade 2: 1–5%, grade 3: 5–15%, grade 4: 15–40%, and grade 5: >40%. Grey areas represent those areas where either no brain structure was present or no eGFP staining was seen. The numbers below each heat map represent the brain coronal section from most rostral (slide 1) to most caudal (slide 63). Fig. 7. Heat maps of eGFP staining intensity within neurons throughout the brain of Cynomolgus macaques treated with IV scAAVHSC15-CBA-eGFP. (A) Neuronal eGFP staining in animal 16C33. (B) Neuronal staining in animal 16C45. All sections were scored in a blinded manner as described under Materials and methods. The percent of cell type stained per structure on each slide was grade 1: <1%, grade 2: 1–5%, grade 3: 5–15%, grade 4: 15–40%, and grade 5: >40%. Grey areas represent those areas where either no brain structure was present or no eGFP staining was seen. The numbers below each heat map represent the brain coronal section from most rostral (slide 1) to most caudal (slide 63). Similarly, an IV dose of scAAVHSC7-CBA-eGFP resulted in a broad, intense distribution of astrocytic-like eGFP staining and a neuronal distribution of GFP staining similar to that observed following dosing with scAAVHSC15-CBA-eGFP Overall, eGFP-positive cells were mainly, but not exclusively, glial in nature in these scAAVHSC15-CBA-eGFP - or scAAVHSC7-CBA-eGFP-treated animals (Fig 6A and 6B, Fig 7A and 7B, and Fig 8A and 8B).
Fig. 8. Heat maps of eGFP staining intensity within glia and neurons throughout the brain of Cynomolgus macaques treated with IV scAAVHSC7-CBA-eGFP. (A) Glial staining in animal 16C34. (B) Neuronal staining in animal 16C34. All sections were scored in a blinded manner as described under Materials and methods. The percent of cell type stained per structure on each slide was grade 1: <1%, grade 2: 1–5%, grade 3: 5–15%, grade 4: 15–40%, and grade 5: >40%. Grey areas represent those areas where either no brain structure was present or no eGFP staining was seen. The numbers below each heat map represent the brain coronal section from most rostral (slide 1) to most caudal (slide 63). In addition to widespread transduction of the brain, eGFP staining was detected in neurons in the sensory ganglia (Fig 9A, 9C and 9E) and spinal cord (Fig 9B, 9D and 9F) following a systemic dose of scAAVHSC17-CBA-eGFP (Fig 9A and 9B), scAAVHSC15-CBA-eGFP (Fig 9C and 9D) or scAAVHSC7-CBA-eGFP (Fig 9E and 9F). Longitudinal sections of spinal cords were also taken from animals treated with either scAAVHSC7-CBA-eGFP (Fig 9I) or scAAVHSC15-CBA-eGFP (Fig 9J) which showed eGFP-positive cells with large motor neurons of the ventral horn. Heat maps of the distribution and staining intensity within the spinal cords are shown in Fig 10A and 10B and Fig 11A–11C. For all treated animals, eGFP-positive cells were localized within large motor neurons (cell bodies, dendritic arbors and axons) and in glia-like profiles (seldom in interneurons) in multiple regions of the spinal cord. There was occasional pronounced eGFP staining in glial cells of the dorsal medial and lateral tracts. It should be noted that for animals treated with scAAVHSC17-CBA-eGFP only spinal cord samples from the upper third (rostral in the figure) and lower third (caudal in the figure) were collected and processed. No eGFP-positive cells were seen in the spinal cord of animals treated with vehicle alone (Fig 9H).
Fig. 9. eGFP staining within the DRG and spinal cord in Cynomolgus macaques treated with IV scAAVHSC-CBA-eGFP. (A,B) Animal treated with an IV dose of scAAVHSC17-CBA-eGFP at 1.0 x 1014 vg/kg. (C,D) Animal treated with an IV dose of scAAVHSC15-CBA-eGFP at 0.7 x 1014 vg/kg. (E,F) Animal treated with scAAVHSC7-CBA-eGFP at 0.7 x 1014 vg/kg. (G,H) Animal treated with an IV injection of vehicle alone. eGFP staining in lumbar DRG and cross-sections of lumbar spinal cords are shown in the left and right panels, respectively. The bar represents 500 μm (A, C, E and G) and 50 μm (B, D, F and H). (I) Longitudinal section of lumbar spinal cord from an animal treated with scAAVHSC7-CBA-eGFP. (J) Longitudinal section of lumbar spinal cord from an animal treated with scAAVHSC15-CBA-eGFP. The scale bars in I and J represent 250 μm. Arrows = motor neurons. Fig. 10. Heat maps of eGFP staining intensity within glia, neurons and neuronal axons in spinal cords of Cynomolgus macaques treated with IV scAAVHSC17-CBA-eGFP. (A) Animal H16C32 received an IV injection of scAAVHSC17-CBA-eGFP. (B) Animal 16C26 was treated with an IV injection of scAAVHSC17-CBA-eGFP. Each animal was dosed at 1.0 x 1014 vg/kg. All sections were scored in a blinded manner as described under Materials and methods. Only the rostral and caudal portions of the spinal cords were available for analysis. The percent of cell type stained per structure on each slide was grade 1: <1%, grade 2: 1–5%, grade 3: 5–15%, grade 4: 15–40%, and grade 5: >40%. Grey areas represent those areas where either no cord structure was present or no eGFP staining was seen. The numbers below each heat map represent the spinal cord sections with N = neurons, Ax = axons and A = glia. Animal identifiers are in the upper right of each panel. Fig. 11. Heat maps of eGFP staining intensity within glia, neurons and neuronal axons in spinal cords of Cynomolgus macaques treated with IV scAAVHSC-CBA-eGFP. (A) Animal 16C33 was treated with an IV injection of scAAVHSC15-CBA-eGFP. (B) Animal 16C45 received an IV injection of scAAVHSC15-CBA-eGFP. (C) Animal 16C34 was treated with an IV injection of scAAVHSC7-CBA-eGFP. All animals were dosed at 0.7 x 1014 vg/kg. All sections were scored in a blinded manner as described under Materials and methods. The percent of cell type stained per structure on each slide was grade 1: <1%, grade 2: 1–5%, grade 3: 5–15%, grade 4: 15–40%, and grade 5: >40%. Grey areas represent those areas where either no cord structure was present or no eGFP staining was seen. The numbers below each heat map represent the spinal cord sections with N = neurons, Ax = axons and A = glia. Animal identifiers are in the upper right of each panel. eGFP staining was extensive in the sensory neurons of the sensory ganglia (DRG) of all diameter, in some of the satellite (glial) cells abutting the immuno-positive neuronal cell bodies and present in proximal axons of the nerve and dorsal root in animals treated with scAAVHSC17-CBA-eGFP, scAAVHSC15-CBA-eGFP or scAAVHSC7-CBA-eGFP (Fig 9A, 9C and 9E, respectively). Of the sensory neuronal axons labelled intensively, we could not differentiate between axonal profiles of the sensory neurons or whether the oligodendrocytes that myelinate some of these sensory (Aβ) axons were eGFP positive. The DRGs of animals treated with vehicle alone were negative for eGFP staining (Fig 9G).
The distribution of eGFP staining between glia and neurons in the central (LGN) and peripheral (DRG) nervous systems were assessed in co-labeling studies using glial (S100-β and GFAP) and neuronal (NeuroTrace and NeuN) markers (Fig 12). Both these regions were chosen as they emerged as common regions of high eGFP staining between the capsids. In the LGN, 52%, 62% and 71% of S100-β-labeled glial cells were eGFP - positive, on average, in animals dosed with scAAVHSC17-CBA-eGFP, scAAVHSC15-CBA-eGFP and scAAVHSC7-CBA-eGFP, respectively (Fig 12A, pink symbols). For all vectors tested, approximately 6–10% of NeuroTrace-positive neurons were also eGFP-positive (Fig 12A, purple symbols). Overall the eGFP staining scores were below those quantified by immunofluorescense combined with confocal microscopy. We attribute these differences to sensitivity of the assays utilized to provide the associated scores. Within the DRG of the PNS, approximately 62%, 49%, and 45% of NeuN-positive neurons were eGFP-positive in animals dosed with scAAVHSC17-CBA-eGFP, scAAVHSC15-CBA-eGFP and scAAVHSC7-CBA-scGFP (Fig 12B, purple symbols) and about 8–9% of GFAP-positive glial cells were eGFP-positive (Fig 12B, pink symbols).
Fig. 12. Variation in the transduction efficiency of glia and neurons in the central and peripheral nervous systems. (A) Quantitation of eGFP immunostaining in the LGN of the CNS [S100-β+ (glia); n = 6 sections of tissue from 1–2 animals/capsid; NeuroTrace+ (neurons); n = 6–11 sections of tissue from 1–2 animals/capsid]. (B) Quantitation of eGFP staining in the DRG of the PNS [GFAP+ (glia); n = 7–10 sections of tissue from 1–2 animals/capsid; (NeuN+ (neurons); n = 10–16 sections of tissue from 1–2 animals/capsid). For scAAVHSC7-CBA-eGFP, tissue from one animal was stained. Individual data points are shown along with mean ± SEM. *p < 0.05; **p < 0.005; ***p < 0.001; one-way ANOVA with Tukey’s multiple comparisons test. All glia counts were within 100 μm x 100 μm areas and DRG neuron counts were within 200 μm x 200 μm. For these, each data point represents the average of counts from 3 ROIs within a single image. For neuron counts in LGN, each data point represents counts from an entire single image (500 μm x 500 μm). HSC17 = scAAVHSC17-CBA-eGFP, HSC15 = scAAVHSC15-CBA-eGFP, HSC7 = scAAVHSC7-CBA-eGFP. To identify neuronal and glial cell types transduced by the AAVHSCs in nonhuman primates, sections of the brain and spinal cord were prepared and sequentially stained for eGFP and markers for neurons (NeuN, SMI-32, or calbindin), oligodendrocytes (MBP), or astrocytes (GFAP, S100-β or ALDH1L1). Representative sections of animals treated with scAAVHSC17-CBA-eGFP, scAAVHSC15-CBA-eGFP, or scAAVHSC7-CBA-eGFP are shown (Figs 13 and 14). In these animals, cell bodies and dendrites that stained positive for eGFP co-stained with markers for neurons within each of the brain regions examined including the cortex, putamen, LGN, hippocampus, and cerebellum (Fig 13A–13E). In the spinal cord, large motor neurons within the ventral horn were co-labeled with antibodies to eGFP and NeuN (Fig 13F) and in the DRG, cell bodies of sensory neurons were strongly positive for both eGFP and NeuN (Fig 13G) alongside a few eGFP-positive satellite cells. Similar staining profiles were observed for each of the scAAVHSC-CBA-eGFP tested. Within the cortex, highly branched, eGFP-positive cells were co-labeled with the astrocyte markers S100-β and GFAP (Fig 14A and 14B, respectively) as well as the oligodendrocyte marker MBP (Fig 14C). Similarly, in the hippocampus, LGN and spinal cord, eGFP-positive cells co-stained with S100-β confirming their astrocyte profiles (Fig 14D, 14E and 14G, respectively). Within the cerebellum, the cell bodies and radial processes characteristic of Bergmann glial cells were stained for eGFP and the astrocyte marker ALDH1L1 (Fig 14F). These data demonstrate that the AAVHSCs have tropism for astrocytes, oligodendrocytes, satellite cells and neurons throughout the central and peripheral nervous systems following systemic delivery in nonhuman primates.
Fig. 13. Colocalization of eGFP immunofluorescence with neuronal markers in multiple brain regions of nonhuman primates treated with an IV dose of scAAVHSC-CBA-eGFP. (A, D, E) Animals received an intravenous dose of scAAVHSC15-CBA-eGFP. (B, C, F) Animals received an intravenous dose of scAAVHSC17-CBA-eGFP. (G) The animal received an intravenous dose of scAAVHSC7-CBA-eGFP. eGFP-positive cells exhibiting neuronal-like profiles co-labeled with the neuronal markers NeuN (A, B, D, F, G), neurofilament H (SMI-32) (C), or calbindin (E). In all panels, arrows indicate colocalization. Scale bars represent 50 μm. Fig. 14. Colocalization of eGFP immunofluorescence with glial markers in multiple brain regions of nonhuman primates treated with an IV dose of scAAVHSC-CBA-eGFP. (A, B, C, F) Animals were dosed with scAAVHSC7-CBA-eGFP. (D, E) Animals were dosed with scAAVHSC15-CBA-eGFP. (G) The animal was dosed with scAAVHSC17-CBA-eGFP. Glial-like profiles of eGFP-positive cells included protoplasmic and fibrous astrocytes (A, B and D-G, respectively) as well as oligodendrocytes (C). The identity of cells with these profiles was confirmed with either myelin basic protein (MBP), a marker exclusively expressed by myelinating glia including oligodendrocytes (C) or astrocyte markers, including S100-β (A, D, E, G), glial fibrillary acidic protein (GFAP) (B), and ALDH1L1 (F). In all panels, arrows indicate colocalization. Green circle in C denotes the location of the oligodendrocyte cell body. Dashed circle in G marks an eGFP-positive cell with a glial-like profile that has no S100-β expression. Scale bars represent 50 μm. Within the retinas of macaques treated with IV scAAVHSC15-CBA-eGFP and scAAVHSC7-CBA-eGFP, the cells in the retinal ganglion cell layer and their afferent fibers, processes within the inner plexiform layer and the inner nuclear layer showed eGFP staining (Fig 15C and 15D). In the inner nuclear layer, it was not evident as to whether neuronal and glial (Müller) profiles were equally eGFP-positive, albeit their endfeet appeared stained in the retinal ganglion cell layer. In contrast, relatively little eGFP staining was apparent in the retina of animals treated with vehicle alone or in the retina of animals treated with IV scAAVHSC17-CBA-eGFP (Fig 15A and 15B, respectively). In all animals, the observed eGFP staining was bilateral.
Fig. 15. eGFP staining in the retinas of Cynomolgus macaques following IV delivery of scAAVHSC-CBA-eGFP. (A) Animals received an IV dose of vehicle alone. (B) The animal was treated with an IV dose of scAAVHSC17-CBA-eGFP. (C) The animal was treated with an IV dose of scAAVHSC15-CBA-eGFP. (D) The animal received an IV dose of scAAVHSC7-CBA-eGFP. Tissues were harvested two weeks post-dosing and processed for eGFP staining as described under Materials and methods. Brown color represents eGFP detection. Tissue sections were counterstained with thionine. PR = photoreceptor layer, ONL = outer nuclear layer, OPL = outer plexiform layer, INL = inner nuclear layer, IPL = inner plexiform layer, GCL = ganglion cell layer. IV delivery of scAAVHSC-CBA-eGFP results in transduction of peripheral tissues in nonhuman primates
A single IV injection of scAAVHSC17-CBA-eGFP, scAAVHSC15-CBA-eGFP or scAAVHSC7-CBA-eGFP led to extensive transduction of the liver (Fig 16B–16D and 16F–16H), cardiac muscle (Fig 16J–16L) and skeletal muscle [Fig 16N–16P (gastrocnemius) and Fig 16R–16T (soleus)] of these animals. No eGFP signal was seen in tissues from animals treated with vehicle alone (Fig 16A, 16E, 16I, 16M and 16Q). In liver, there was stronger periportal eGFP signal compared with eGFP expression in the centrilobular region for each of the vectors tested. Semi-quantitative scoring of eGFP staining was performed for peripheral tissues with the liver of an animal treated with scAAVHSC17-CBA-eGFP as an example shown in S3 Fig. Livers from animals treated with either scAAVHSC17-CBA-eGFP or scAAVHSC15-CBA-eGFP had 1+ to 3+ cytoplasmic signal in virtually all hepatocytes. Periportal macrophages had 1+ to 2+ cytoplasmic signal and endothelial cells of the larger blood vessels had a 1+ cytoplasmic signal. eGFP expression in the liver of the animal treated with scAAVHSC7-CBA-eGFP was intense (Fig 16D and 16H) with 2+ to 3+ cytoplasmic signal in all hepatocytes. Again, periportal macrophages, endothelial cells and smooth muscle cells of some blood vessels, had 1+ to 2+ cytoplasmic signal.
Fig. 16. Widespread eGFP staining in peripheral tissues of nonhuman primates dosed with scAAVHSC-CBA-eGFP. (A, E, I, M, Q) The animal received an IV dose of vehicle alone. (B, F, J, N, R) The animal received an IV dose of scAAVHSC17-CBA-eGFP. (C, G, K, O, S) The animal received an IV dose of scAAVHSC15-CBA-eGFP. (D, H, L, P, T) The animal received an IV dose of scAAVHSC7-CBA-eGFP. Tissues were harvested two weeks post-dose and were processed for eGFP staining as described under Materials and methods. Representative tissues shown are: liver (A-D) with higher magnification views of boxed areas shown in E-H; cardiac muscle (I-L), gastrocnemius muscle (M-P), and soleus muscle (Q-T). Brown staining represents eGFP staining. In the heart, eGFP staining was generally similar for all three AAVHSCs with 1+ to 3+ cytoplasmic signal in many of the cardiomyocytes of the ventricular and atrial walls (Fig 16J–16L). Cytoplasmic eGFP staining was observed in skeletal myocytes in all skeletal muscle tissues analyzed including the gastrocnemius (Fig 16N–16P), soleus (Fig 16R–16T), biceps (S4G Fig and S4H Fig) and diaphragm (S4I and S4J Fig). In the esophagus (S4 Fig) most skeletal muscle fibers in the muscular wall had 1+ to 3+ eGFP signal in their cytoplasm. Smooth muscle fibers in both the muscular wall and muscularis mucosa had 1+ cytoplasmic signal. No eGFP staining was seen in the esophageal, biceps or diaphragm skeletal muscle sections treated with a non-immune anti-serum control (S4 Fig). Biceps, diaphragm and esophageal tissues were not collected from animals treated with scAAVHSC17-CBA-eGFP or the vehicle control.
Bronchial and bronchiolar epithelium of the lung were positive for eGFP staining after systemic delivery of scAAVHSC-CBA-eGFP (Fig 17B–17D). A modest 1+ to 2+ cytoplasmic signal was evident, particularly in the mucus component of goblet cells, of all treated animals. Lung alveoli were negative for eGFP staining in all treated animals and no eGFP staining was evident within the large airway epithelium of animals treated with vehicle alone (Fig 17A).
Fig. 17. eGFP staining in peripheral tissues of Cynomolgus macaques dosed with scAAVHSC-CBA-eGFP. (A, E, I, M, Q) The animal received an IV dose of vehicle alone. (B, F, J, N, R) The animal received an IV dose of scAAVHSC17-CBA-eGFP. (C, G, K, O, S) The animal received an IV dose of scAAVHSC15-CBA-eGFP. (D, H, L, P, T) The animal received an IV dose of scAAVHSC7-CBA-eGFP. Tissues were processed for eGFP staining as described under Materials and methods. Representative tissues shown are: lung, large airway epithelium (A-D), kidney cortex (E-H); kidney medulla (I-L), pancreas (M-P), and testes (Q-T). Brown staining represents eGFP staining. eGFP staining in the kidney cortex of treated animals was largely confined to the macula densa or proximal tubular epithelia region directly adjacent to the glomeruli, with 1+ to 3+ cytoplasmic signal observed (Fig 17F–17H). eGFP staining (1+ to 3+ cytoplasmic signal) was also seen in evenly scattered tubular epithelia cells in the medulla (Fig 17J–17L) with relatively greater staining in this region in the animal dosed with scAAVHSC7-CBA-eGFP.
In the pancreas, eGFP staining was largely confined to clusters of acinar cells with 1+ to 3+ cytoplasmic signal observed in each animal treated with scAAVHSC-CBA-eGFP. Islet cells were largely negative for eGFP staining; however, a few scattered cells within some islets were 1+ to 2+ eGFP-positive (Fig 17N–17P).
Spermatogonia were negative for eGFP staining in all treated animals. Individual evenly-spaced Leydig cells had 1+ to 3+ cytoplasmic eGFP signal (Fig 17R–17T) and a few of the epithelial cells of the rete testes had 1+ to 2+ cytoplasmic eGFP signal. Cremaster muscle around the testes showed 1+ to 3+ cytoplasmic eGFP signal.
Treatment of macaques with IV scAAVHSC17-CBA-eGFP, scAAVHSC15-CBA-eGFP, or scAAVHSC7-CBA-eGFP produced eGFP staining in all immune tissues examined. In the spleen, 1+ to 3+ cytoplasmic eGFP staining was evident in branched and round cells primarily in the mantle zone and germinal centers of most lymphoid follicles (Fig 18B–18D and 18F–18H). The percent of total spleen cells scored as 2+ and 3+ was similar for all three capsids (0.4 to 0.8% eGFP positive). While similar levels of 1+ eGFP staining were seen for animals treated with scAAVHSC7-CBA-eGFP and scAAVHSC15-CBA-eGFP, (0.5% and 0.7% of total spleen cells, respectively), animals treated with scAAVHSC17-CBA-eGFP showed relatively fewer 1+ eGFP stained cells (0.1% of total spleen cells). eGFP staining was also observed within the germinal centers of most follicles of the mesenteric and peripheral lymph nodes in animals treated with scAAVHSC-CBA-eGFP (Fig 18N–18P and 18R–18T). In the thymus, eGFP staining was highly-localized to the epithelial cells of Hassall’s corpuscle, where 1+ to 3+ cytoplasmic signal was observed in animals treated with scAAVHSC-CBA-eGFP (Fig 18J–18L). For animals treated with vehicle alone, no eGFP staining was observed in any of the tissues described above (Fig 17 and Fig 18, far left panels).
Fig. 18. eGFP detection in lymphoid tissue of nonhuman primates treated with scAAVHSC-CBA-eGFP. (A, E, I, M, Q) The animal received an IV dose of vehicle alone. (B, F, J, N, R) The animal received an IV dose of scAAVHSC17-CBA-eGFP. (C, G, K, O, S) The animal received an IV dose of scAAVHSC15-CBA-eGFP. (D, H, L, P, T) The animal received an IV dose of scAAVHSC7-CBA-eGFP. Tissues were isolated two weeks post-dose for eGFP staining as described under Materials and methods. White pulp splenic nodules are shown in A-D with higher magnification views of the boxed areas shown in F-H. eGFP staining in Hassall’s bodies (arrows) of the thymic medulla are shown in I-L, and eGFP staining within the germinal centers of mesenteric (MLN) and peripheral (PLN) lymph nodes are shown in M-P and Q-T, respectively. Brown staining represents eGFP staining. Representative tissues are shown. Other than a 1+ to 2+ cytoplasmic eGFP-positive signal observed in the entire muscular wall of the duodenum, jejunum and colon only a few scattered epithelial cells, predominately located within the intestinal crypts, showed a 1+ to 3+ cytoplasmic eGFP staining in animals treated with scAAVHSC-CBA-eGFP. The remainder of the intestinal epithelium was largely negative for eGFP staining.
In a sample of skin from the forearm of animals treated with scAAVHSC-CBA-eGFP, 1+ to 2+ cytoplasmic eGFP staining was seen in most arrector pili smooth muscle cells and occasional sweat gland epithelial cells in the dermis. Occasional scattered sebaceous epithelial cells also showed 1+ to 3+ cytoplasmic eGFP staining.
Biodistribution of eGFP vector genomes in nonhuman primates treated with IV scAAVHSC-CBA-eGFP
Tissue samples were harvested from multiple regions of fixed brain and peripheral tissues from animals treated with scAAVHSC17-CBA-eGFP, scAAVHSC15-CBA-eGFP, or scAAVHSC7-CBA-eGFP for vector genome quantitation. eGFP vector genomes were present in every region of the brain examined with higher levels seen in the pons, hippocampus, medulla and some cortical areas (Fig 19A), findings consistent with the observed eGFP IHC in corresponding regions. The levels of eGFP vector genomes in the cerebellum were low, only animals treated with scAAVHSC17-CBA-eGFP were above those observed with vehicle alone (Fig 19A). In peripheral tissues, the liver contained the highest level of eGFP vector genomes for each of the scAAVHSC-CBA-eGFP tested (Fig 19B). The order of relative potency for transduction of liver, measured by eGFP vector genomes, was scAAVHSC7-CBA-eGFP > scAAVHSC15-CBA-eGFP>>scAAVHSC17-CBA-eGFP, findings consistent with eGFP expression measured by IHC. Immune tissues and lung from animals treated with scAAVHSC-CBA-eGFP also showed relatively high levels of eGFP vector genomes (Fig 19B). For scAAVHSC7-CBA-eGFP, high levels of eGFP vector genomes were also present in kidney, soleus and gastrocnemius muscles and sternum (Fig 19B); for scAAVHSC15-CBA-eGFP high levels of eGFP vector genomes were also detected within pancreas, heart and sternum (Fig 19B); and for scAAVHSC17-CBA-eGFP duodenum, pancreas and heart also showed high levels of eGFP vector genomes (Fig 19B). In the duodenum, the eGFP vector genomes were likely due to transduction of contaminating skeletal/smooth muscle within the isolated tissues. In most of these tissues, transduction by scAAVHSC7-CBA-eGFP and scAAVHSC15-CBA-scGFP exceeded that of scAAVHSC17-CBA-scGFP (Fig 19B).
Fig. 19. Biodistribution of scAAVHSC-CBA-eGFP in the brain and peripheral organs of nonhuman primates. (A) Levels of vector genomes in the brain of animals treated with an IV dose of scAAVHSC17-CBA-eGFP (black bars), scAAVHSC15-CBA-eGFP (blue bars) or scAAVHSC7-CBA-eGFP (grey bars). (B) Levels of vector genomes within peripheral tissues of animals treated with an IV dose of scAAVHSC17-CBA-eGFP (black bars), scAAVHSC15-CBA-eGFP (blue bars) or scAAVHSC7-CBA-eGFP (grey bars). Two weeks after dosing tissues were harvested and processed for GFP vector genome analyses as described under Materials and methods. The bars in panel A represent the mean ± SD of n = 2–12 pieces of tissue from each brain area of each animal with each assay performed in triplicate. The background level of eGFP vector genomes/cell measured across all brain areas in animals treated with vehicle was 0.009. The bars in panel B represent the mean ± SD of n = 6 tissue sections from each animal treated with scAAVHSC15-CBA-eGFP or scAAVHSC17-CBA-eGFP and n = 3 tissue sections from the animal treated with scAAVHSC7-CBA-eGFP. Eye samples were tissues sections taken through an intact fixed eye from each animal and retinal images are shown. Olfactory bulb samples were only collected from the animals treated with scAAVHSC17-CBA-eGFP and biceps, diaphragm, and esophageal tissues were only collected from animals treated with scAAVHSC15-CBA-eGFP and scAAVHSC7-CBA-eGFP. MLN = mesenteric lymph node, PLN = peripheral lymph node. Discussion
The results of this study show that three Clade F AAVs, AAVHSC17, AAVHSC15 and AAVHSC7, showed widespread distribution in the nervous system and multiple peripheral tissues following IV delivery in Cynomolgus macaques. eGFP vector genome and eGFP IHC analyses showed transduction and transgene expression throughout the brain in both white and grey matter regions at two weeks post-dose, with the highest levels seen in the pons and LGN for each of the AAVHSCs tested. Detection of eGFP staining was also seen throughout the cortex and midbrain structures predominately within glial cells. While an enrichment in glial transduction was observed in most of these cerebral regions, eGFP staining was also confirmed within neuronal cell bodies, proximal dendritic arborization, and axons throughout. These data are consistent with previous reports for another Clade F virus, AAV9, which can effectively cross the BBB after IV administration in nonhuman primates [18, 19] supporting the claim that the ability to efficiently cross the BBB may be a feature of Clade F AAVs. A number of native and engineered recombinant AAVs from other clades have been shown to cross the BBB in mice following systemic delivery [25–28] for reviews and [29–32] with only a few of these vectors studied in larger animals to date [33]. In some cases moreover, translation of the biodistribution data observed in mice to nonhuman primates has been poor [21, 34, 35], emphasizing the importance of studying the tissue tropism of AAV in large animals that may more closely reflect the underlying biology in humans.
In addition to transduction of the brain, AAVHSCs effectively targeted the spinal cord and associated DRG demonstrating tropism to the broader nervous system, in glial and neuronal profiles and the ability to cross the BNB in addition to the BBB. Of note, the neuron to glia transduction was reversed to that of the LGN in the DRG. Transduction of neurons with the sensory ganglia has been observed for Clade F AAV in other studies in nonhuman primates [18] consistent with the data for the AAVHSCs in the current report. The mechanism for enhanced sensory neuron tropism in the periphery is not yet clear. In the spinal cord gray matter, astrocyte-like profiles and large motor neurons showed extensive eGFP staining. For each scAAVHSC-CBA-eGFP tested, eGFP staining was highest within the lumbar region with varying immunoreactivity patterns across the rostro-caudal gradient of the spinal cord. The reason for the relative lack of eGFP staining within the thoracic region is not clear, possibly signifying differences in vascular or regional expression of AAV binding receptors. The absence of large pools of motor neurons within this region may also give an appearance of lower signal since they predominate in the regions innervating the limbs (to this note, the brachial enlargement innervating the forelimbs was not evaluated). The extensive eGFP staining in sensory neurons of the DRG and in the proximal axons of the spinal nerve and the dorsal roots seen with systemic delivery of AAVHSCs extend the findings observed with AAV9 [18, 19] to other members of AAV Clade F.
The mechanism by which Clade F AAVs traverse the BNB or BBB after systemic delivery is not yet established. In a cell culture BBB model system, using brain microvascular endothelial cells (BMVECs), AAV9 appeared to cross the endothelial barrier by transcytosis through tubule-like structures with little or no transduction of the BMVECs or disruption of the BMVEC barrier [36]. Primary human astrocytes, on the other hand, were readily transduced following passage of AAV9 through the endothelial barrier. AAV2, in contrast, was endocytosed resulting in transduction of the BMVECs [36] with little or no transduction of underlying astrocytes [36]. These AAVs thus appear to follow divergent pathways through a brain-derived endothelial barrier in vitro suggesting a mechanism for the BBB permeability to Clade F AAV in vivo. These data are consistent with our findings in the present study where the vascular endothelium in nonhuman primate brain was largely devoid of eGFP staining following IV delivery of scAAVHSC17-, scAAVHSC15-, or scAAVHSC7-CBA-eGFP. AAV9 appears to utilize glycans with terminal N-linked galactose as its primary cellular receptor in conjunction with the laminin receptor as co-receptor [37, 38]. Whether the distribution of these molecules, the AAVR [39] or other pathways [40, 41] on the brain endothelium render the BBB permeable to Clade F AAV is not yet understood. Enhanced BBB crossing by the modified AAV9 vectors, AAV-PHP.B and AAV-PHP.eB, [34] is likely mediated by the GPI-anchored protein LY6A, also known as SCA-1, in C57BL/6J mice [42]. While these findings appear to be strain-specific and do not translate to nonhuman primates [21, 35], lipid raft-associated GPI-anchors could play a key role in AAV transcytosis and transduction as shown for a number of other viruses [43]. Whether a primate ortholog of LY6A or another GPI-anchored membrane protein mediates the transport of Clade F AAVs across the BBB remains to be determined.
As noted above, eGFP staining in the brain was predominately localized in glial cells which on thionine counterstaining exhibited the morphology of astrocytes. This observation was confirmed by colocalization of eGFP with classic glial cell markers. While astrocytic-like staining was most abundant, transduction of other glial cell types in the CNS such as oligodendrocytes, cells of the choroid plexus and Müller glia or the PNS such as satellite cells were also observed suggesting a potential for transduction by these capsids of a large and diversified number of glial cell type in the nervous system. In a similar manner, eGFP-positive neuronal profiles were observed throughout the nervous system and their identity confirmed by co-labeling with neuronal markers.
In the periphery, AAVHSCs exhibit high levels of tropism for the liver and skeletal muscle throughout the body. The eGFP staining and vector genome data suggest that all three exhibit high tropism for the liver in addition to effectively transducing multiple other tissues, including skeletal muscle and heart, after a single IV injection. In addition to the work described here, we have observed differences in transgene biodistribution after a single IV injection of these and additional AAVHSCs in mice suggesting that some vectors may have greater tropism for targeting specific tissues [44]. It should be noted that eGFP staining by IHC was generally correlated with eGFP vector genomes in corresponding tissue. This was especially true for relatively homogenous tissues such as liver. However, the high muscle tropism of the AAVHSCs complicates interpretation of the vector genome analyses where contaminating or integral muscle tissue may be present (as was observed in the duodenal sample of the animals treated with scAAVHSC17-CBA-eGFP). The multinucleated nature of each myofiber also complicates the vector genome analyses as a myofiber can be strongly eGFP positive yet have few vector genomes per nucleus. Nevertheless, the widespread transduction of multiple peripheral tissues is expected with systemic administration of AAVs. Our data agrees with published work for systemic delivery of the other Clade F member; AAV9 [18, 19], where these tissues are also targeted. Moreover, the differences observed in regional and cell type tropism with the characterized AAVHSCs allows for tuning of capsid selection for diseases of the nervous system. By overlaying the key ascending and descending neuronal pathways connecting the periphery to the CNS (and vice versa) and/or the cell-types mostly affected in a given neurological disease (glia vs. neurons or both), one can select the biologically relevant capsids for the desired neuronal/glial endpoints and also the peripheral organs that may benefit from the therapy via an IV route of administration.
A recent report documented acute hepatotoxicity, coagulopathy, and severe inflammation in a rhesus macaque and toxicity to sensory neurons within the DRG in newborn piglets that received an IV dose (2 x1014 vg/kg) of an engineered AAV9 variant AAVhu68 packaging a human SMN transgene [45]. We have not observed these findings following systemic dosing of normal 4 - to 5-month old cynomolgus macaques with scAAVHSC-CBA-eGFP at the doses tested and over the time course utilized. All animals appeared healthy in our study with no behavioral changes noted and livers appeared normal at necropsy. Our data are consistent with gene therapy trials in patients with spinal muscular atrophy treated with systemic AAV9-SMN1 at 2 x1014 vg/kg that have shown remarkable efficacy with little observed toxicity [5]. Zolgensma was, in fact, recently approved by the FDA for pediatric SMA patients at a IV dose of 1.1 x1014 vg/kg [20].
The broad PNS/CNS distribution of the naturally-occurring Clade F AAVHSCs, suggests their potential for treating neurological diseases by systemic administration. The success of IV AAV9-SMN in treating patients with spinal muscular atrophy supports and validates this view. The hepatic and peripheral tissue tropism further suggests an AAVHSC-mediated approach for treating genetic diseases of the periphery including liver, skeletal muscle and heart. A factor that can limit the therapeutic utility of systemically delivered AAVs is the level of anti-AAV neutralizing antibodies present within the circulation [46]. We have recently shown that the seroprevalences of neutralizing antibodies targeting AAVHSC17 and AAVHSC15 in humans are low [47] enabling the use of these AAVHSCs for systemic delivery within the general population. The AAVHSCs have shown high-efficiency, nuclease-free gene editing both in vitro with cultured human and rodent cells and in vivo in mice [11]. An approach coupling the wide tissue tropism of the AAVHSCs following IV delivery with homology-driven gene editing or gene transfer using tissue-specific regulatory elements may have therapeutic potential for durably treating a wide variety of genetic diseases in humans.
Supporting information
S1 Fig [tif]
High magnification photomicrographs of eGFP staining within glial and neuronal cells in multiple brain regions of nonhuman primates treated with an IV dose of scAAVHSC-CBA-eGFP.S2 Fig [tif]
Endothelial cells of the brain vasculature show little or no eGFP staining following IV delivery of scAAVHSC17-CBA-eGFP.S3 Fig [tif]
Semi-quantitative scoring of eGFP staining in peripheral tissues.S4 Fig [tif]
eGFP staining within skeletal muscle of nonhuman primates following IV dosing with scAAVHSC-CBA-eGFP.
Zdroje
1. Bainbridge JW, Mehat MS, Sundaram V, Robbie SJ, Barker SE, Ripamonti C, et al. Long-term effect of gene therapy on Leber's congenital amaurosis. N Engl J Med. 2015;372(20):1887–97. Epub 2015/05/06. doi: 10.1056/NEJMoa1414221 25938638; PubMed Central PMCID: PMC4497809.
2. Edwards TL, Jolly JK, Groppe M, Barnard AR, Cottriall CL, Tolmachova T, et al. Visual Acuity after Retinal Gene Therapy for Choroideremia. N Engl J Med. 2016;374(20):1996–8. Epub 2016/04/28. doi: 10.1056/NEJMc1509501 27120491; PubMed Central PMCID: PMC4996318.
3. George LA, Sullivan SK, Giermasz A, Rasko JEJ, Samelson-Jones BJ, Ducore J, et al. Hemophilia B Gene Therapy with a High-Specific-Activity Factor IX Variant. N Engl J Med. 2017;377(23):2215–27. Epub 2017/12/07. doi: 10.1056/NEJMoa1708538 29211678; PubMed Central PMCID: PMC6029626.
4. Maguire AM, Simonelli F, Pierce EA, Pugh EN Jr., Mingozzi F, Bennicelli J, et al. Safety and efficacy of gene transfer for Leber's congenital amaurosis. N Engl J Med. 2008;358(21):2240–8. Epub 2008/04/29. doi: 10.1056/NEJMoa0802315 18441370; PubMed Central PMCID: PMC2829748.
5. Mendell JR, Al-Zaidy S, Shell R, Arnold WD, Rodino-Klapac LR, Prior TW, et al. Single-Dose Gene-Replacement Therapy for Spinal Muscular Atrophy. N Engl J Med. 2017;377(18):1713–22. Epub 2017/11/02. doi: 10.1056/NEJMoa1706198 29091557.
6. Rangarajan S, Walsh L, Lester W, Perry D, Madan B, Laffan M, et al. AAV5-Factor VIII Gene Transfer in Severe Hemophilia A. N Engl J Med. 2017;377(26):2519–30. Epub 2017/12/12. doi: 10.1056/NEJMoa1708483 29224506.
7. Patricio MI, Barnard AR, Xue K, MacLaren RE. Choroideremia: molecular mechanisms and development of AAV gene therapy. Expert Opin Biol Ther. 2018 : 1–14. Epub 2018/06/23. doi: 10.1080/14712598.2018.1484448 29932012.
8. Simonelli F, Maguire AM, Testa F, Pierce EA, Mingozzi F, Bennicelli JL, et al. Gene therapy for Leber's congenital amaurosis is safe and effective through 1.5 years after vector administration. Mol Ther. 2010;18(3):643–50. Epub 2009/12/03. doi: 10.1038/mt.2009.277 19953081; PubMed Central PMCID: PMC2839440.
9. Penaud-Budloo M, Francois A, Clement N, Ayuso E. Pharmacology of Recombinant Adeno-associated Virus Production. Mol Ther Methods Clin Dev. 2018;8 : 166–80. Epub 2018/04/25. doi: 10.1016/j.omtm.2018.01.002 29687035; PubMed Central PMCID: PMC5908265.
10. Smith LJ, Ul-Hasan T, Carvaines SK, Van Vliet K, Yang E, Wong KK Jr., et al. Gene transfer properties and structural modeling of human stem cell-derived AAV. Mol Ther. 2014;22(9):1625–34. Epub 2014/06/14. doi: 10.1038/mt.2014.107 24925207; PubMed Central PMCID: PMC4435483.
11. Smith LJ, Wright J, Clark G, Ul-Hasan T, Jin X, Fong A, et al. Stem cell-derived clade F AAVs mediate high-efficiency homologous recombination-based genome editing. Proc Natl Acad Sci U S A. 2018;115:E7379–E88. Epub 2018/07/19. doi: 10.1073/pnas.1802343115 30018062.
12. Ahmed S, Ellsworth JL, Francone O, Faulkner D, Sengooba A, Dollive S, et al. Sustained Correction of Phenylketonuria by a Single Dose of AAVHSC Packaging a Human Phenylalanine Hydroxylase Transgene. Molecular Therapy. 2018;26(5S1):252.
13. Ellsworth JL, Smith LJ, Rubin H, Seymour A, Morales PR, Chlipala E, et al. Widespread Transduction of the Central Nervous System Following Systemic Delivery of AAVHSC17 in Non-Human Primates. Mol Ther. 2017;25(5S1):262.
14. Gao G, Vandenberghe LH, Alvira MR, Lu Y, Calcedo R, Zhou X, et al. Clades of Adeno-associated viruses are widely disseminated in human tissues. J Virol. 2004;78(12):6381–8. Epub 2004/05/28. doi: 10.1128/JVI.78.12.6381-6388.2004 15163731; PubMed Central PMCID: PMC416542.
15. Foust KD, Nurre E, Montgomery CL, Hernandez A, Chan CM, Kaspar BK. Intravascular AAV9 preferentially targets neonatal neurons and adult astrocytes. Nat Biotechnol. 2009;27(1):59–65. Epub 2008/12/23. doi: 10.1038/nbt.1515 19098898; PubMed Central PMCID: PMC2895694.
16. Duque S, Joussemet B, Riviere C, Marais T, Dubreil L, Douar AM, et al. Intravenous administration of self-complementary AAV9 enables transgene delivery to adult motor neurons. Mol Ther. 2009;17(7):1187–96. Epub 2009/04/16. doi: 10.1038/mt.2009.71 19367261; PubMed Central PMCID: PMC2835208.
17. Jackson KL, Dayton RD, Klein RL. AAV9 supports wide-scale transduction of the CNS and TDP-43 disease modeling in adult rats. Mol Ther Methods Clin Dev. 2015;2 : 15036. Epub 2015/10/09. doi: 10.1038/mtm.2015.36 26445725; PubMed Central PMCID: PMC4588447.
18. Bevan AK, Duque S, Foust KD, Morales PR, Braun L, Schmelzer L, et al. Systemic gene delivery in large species for targeting spinal cord, brain, and peripheral tissues for pediatric disorders. Mol Ther. 2011;19(11):1971–80. Epub 2011/08/04. doi: 10.1038/mt.2011.157 21811247; PubMed Central PMCID: PMC3222525.
19. Gray SJ, Matagne V, Bachaboina L, Yadav S, Ojeda SR, Samulski RJ. Preclinical differences of intravascular AAV9 delivery to neurons and glia: a comparative study of adult mice and nonhuman primates. Mol Ther. 2011;19(6):1058–69. Epub 2011/04/14. doi: 10.1038/mt.2011.72 21487395; PubMed Central PMCID: PMC3129805.
20. AveXis receives FDA approval for Zolgensma®, the first and only gene therapy for pediatric patients with spinal muscular atrophy (SMA) [Website]. 2019 [updated May 24, 2019]. Available from: http://www.novartis.com.
21. Hordeaux J, Wang Q, Katz N, Buza EL, Bell P, Wilson JM. The Neurotropic Properties of AAV-PHP.B Are Limited to C57BL/6J Mice. Mol Ther. 2018;26(3):664–8. Epub 2018/02/13. doi: 10.1016/j.ymthe.2018.01.018 29428298; PubMed Central PMCID: PMC5911151.
22. Saunders NR, Dreifuss JJ, Dziegielewska KM, Johansson PA, Habgood MD, Mollgard K, et al. The rights and wrongs of blood-brain barrier permeability studies: a walk through 100 years of history. Front Neurosci. 2014;8 : 404. Epub 2015/01/08. doi: 10.3389/fnins.2014.00404 25565938; PubMed Central PMCID: PMC4267212.
23. Saunders NR, Liddelow SA, Dziegielewska KM. Barrier mechanisms in the developing brain. Front Pharmacol. 2012;3 : 46. Epub 2012/04/06. doi: 10.3389/fphar.2012.00046 22479246; PubMed Central PMCID: PMC3314990.
24. Smith L, Kauss A, Wong KK Jr., Chatterjee S. Enhanced Hepatic Transgene Expression Following Intravenous Delivery of Novel Stem Cell-Derived Recombinant AAV Vectors. Mol Ther. 2010;18(supplement 1):S1–S2.
25. Ojala DS, Amara DP, Schaffer DV. Adeno-associated virus vectors and neurological gene therapy. Neuroscientist. 2015;21(1):84–98. Epub 2014/02/22. doi: 10.1177/1073858414521870 24557878.
26. Murlidharan G, Samulski RJ, Asokan A. Biology of adeno-associated viral vectors in the central nervous system. Front Mol Neurosci. 2014;7 : 76. Epub 2014/10/07. doi: 10.3389/fnmol.2014.00076 25285067; PubMed Central PMCID: PMC4168676.
27. Saraiva J, Nobre RJ, Pereira de Almeida L. Gene therapy for the CNS using AAVs: The impact of systemic delivery by AAV9. J Control Release. 2016;241 : 94–109. Epub 2016/10/19. doi: 10.1016/j.jconrel.2016.09.011 27637390.
28. Wang D, Gao G. Taking a Hint from Structural Biology: To Better Understand AAV Transport across the BBB. Mol Ther. 2018;26(2):336–8. Epub 2018/02/06. doi: 10.1016/j.ymthe.2018.01.005 29398483; PubMed Central PMCID: PMC5835224.
29. Albright BH, Storey CM, Murlidharan G, Castellanos Rivera RM, Berry GE, Madigan VJ, et al. Mapping the Structural Determinants Required for AAVrh.10 Transport across the Blood-Brain Barrier. Mol Ther. 2018;26(2):510–23. Epub 2017/11/28. doi: 10.1016/j.ymthe.2017.10.017 29175157; PubMed Central PMCID: PMC5835146.
30. Hudry E, Andres-Mateos E, Lerner EP, Volak A, Cohen O, Hyman BT, et al. Efficient Gene Transfer to the Central Nervous System by Single-Stranded Anc80L65. Mol Ther Methods Clin Dev. 2018;10 : 197–209. Epub 2018/08/16. doi: 10.1016/j.omtm.2018.07.006 30109242; PubMed Central PMCID: PMC6083902.
31. Kanaan NM, Sellnow RC, Boye SL, Coberly B, Bennett A, Agbandje-McKenna M, et al. Rationally Engineered AAV Capsids Improve Transduction and Volumetric Spread in the CNS. Mol Ther Nucleic Acids. 2017;8 : 184–97. Epub 2017/09/18. doi: 10.1016/j.omtn.2017.06.011 28918020; PubMed Central PMCID: PMC5503098.
32. Wang D, Li S, Gessler DJ, Xie J, Zhong L, Li J, et al. A Rationally Engineered Capsid Variant of AAV9 for Systemic CNS-Directed and Peripheral Tissue-Detargeted Gene Delivery in Neonates. Mol Ther Methods Clin Dev. 2018;9 : 234–46. Epub 2018/05/17. doi: 10.1016/j.omtm.2018.03.004 29766031; PubMed Central PMCID: PMC5948233.
33. Yang B, Li S, Wang H, Guo Y, Gessler DJ, Cao C, et al. Global CNS transduction of adult mice by intravenously delivered rAAVrh.8 and rAAVrh.10 and nonhuman primates by rAAVrh.10. Mol Ther. 2014;22(7):1299–309. Epub 2014/05/02. doi: 10.1038/mt.2014.68 24781136; PubMed Central PMCID: PMC4089005.
34. Deverman BE, Pravdo PL, Simpson BP, Kumar SR, Chan KY, Banerjee A, et al. Cre-dependent selection yields AAV variants for widespread gene transfer to the adult brain. Nat Biotechnol. 2016;34(2):204–9. Epub 2016/02/02. doi: 10.1038/nbt.3440 26829320; PubMed Central PMCID: PMC5088052.
35. Matsuzaki Y, Konno A, Mochizuki R, Shinohara Y, Nitta K, Okada Y, et al. Intravenous administration of the adeno-associated virus-PHP.B capsid fails to upregulate transduction efficiency in the marmoset brain. Neurosci Lett. 2018;665 : 182–8. Epub 2017/11/28. doi: 10.1016/j.neulet.2017.11.049 29175632.
36. Merkel SF, Andrews AM, Lutton EM, Mu D, Hudry E, Hyman BT, et al. Trafficking of adeno-associated virus vectors across a model of the blood-brain barrier; a comparative study of transcytosis and transduction using primary human brain endothelial cells. J Neurochem. 2017;140(2):216–30. Epub 2016/10/09. doi: 10.1111/jnc.13861 27718541; PubMed Central PMCID: PMC5298820.
37. Shen S, Bryant KD, Brown SM, Randell SH, Asokan A. Terminal N-linked galactose is the primary receptor for adeno-associated virus 9. J Biol Chem. 2011;286(15):13532–40. Epub 2011/02/19. doi: 10.1074/jbc.M110.210922 21330365; PubMed Central PMCID: PMC3075699.
38. Nonnenmacher M, Weber T. Intracellular transport of recombinant adeno-associated virus vectors. Gene Ther. 2012;19(6):649–58. Epub 2012/02/24. doi: 10.1038/gt.2012.6 22357511; PubMed Central PMCID: PMC4465241.
39. Pillay S, Meyer NL, Puschnik AS, Davulcu O, Diep J, Ishikawa Y, et al. An essential receptor for adeno-associated virus infection. Nature. 2016;530(7588):108–12. Epub 2016/01/28. doi: 10.1038/nature16465 26814968; PubMed Central PMCID: PMC4962915.
40. Dudek AM, Pillay S, Puschnik AS, Nagamine CM, Cheng F, Qiu J, et al. An Alternate Route for Adeno-associated Virus (AAV) Entry Independent of AAV Receptor. J Virol. 2018;92(7). Epub 2018/01/19. doi: 10.1128/JVI.02213-17 29343568; PubMed Central PMCID: PMC5972900.
41. Weber-Adrian D, Heinen S, Silburt J, Noroozian Z, Aubert I. The human brain endothelial barrier: transcytosis of AAV9, transduction by AAV2: An Editorial Highlight for 'Trafficking of adeno-associated virus vectors across a model of the blood-brain barrier; a comparative study of transcytosis and transduction using primary human brain endothelial cells'. J Neurochem. 2017;140(2):192–4. Epub 2016/12/16. doi: 10.1111/jnc.13898 27976378.
42. Hordeaux J, Yuan Y, Clark PM, Wang Q, Martino RA, Sims JJ, et al. The GPI-Linked Protein LY6A Drives AAV-PHP.B Transport across the Blood-Brain Barrier. Mol Ther. 2019;27(5):912–21. Epub 2019/03/02. doi: 10.1016/j.ymthe.2019.02.013 30819613; PubMed Central PMCID: PMC6520463.
43. Metzner C, Salmons B, Gunzburg WH, Dangerfield JA. Rafts, anchors and viruses—a role for glycosylphosphatidylinositol anchored proteins in the modification of enveloped viruses and viral vectors. Virology. 2008;382(2):125–31. Epub 2008/10/31. doi: 10.1016/j.virol.2008.09.014 18962809.
44. Smith LJ, Kauss A, Wong KK, Chatterjee S. Enhanced Hepatic Transgene Expression Following Intravenous Delivery of Novel Stem Cell-Derived Recombinant AAV Vectors. Molecular Therapy. 2010;18(Supplement 1):S1–S2.
45. Hinderer C, Katz N, Buza EL, Dyer C, Goode T, Bell P, et al. Severe Toxicity in Nonhuman Primates and Piglets Following High-Dose Intravenous Administration of an Adeno-Associated Virus Vector Expressing Human SMN. Hum Gene Ther. 2018;29(3):285–98. Epub 2018/01/31. doi: 10.1089/hum.2018.015 29378426; PubMed Central PMCID: PMC5865262.
46. Colella P, Ronzitti G, Mingozzi F. Emerging Issues in AAV-Mediated In Vivo Gene Therapy. Mol Ther Methods Clin Dev. 2018;8 : 87–104. Epub 2018/01/13. doi: 10.1016/j.omtm.2017.11.007 29326962; PubMed Central PMCID: PMC5758940.
47. Ellsworth JL, O'Callaghan M, Rubin H, Seymour A. Low Seroprevalence of Neutralizing Antibodies Targeting Two Clade F AAV in Humans. Hum Gene Ther Clin Dev. 2018;29(1):60–7. Epub 2018/04/07. doi: 10.1089/humc.2017.239 29624457.
Článek A study of psychological pain in substance use disorder and its relationship to treatment outcomeČlánek Addiction of mesenchymal phenotypes on the FGF/FGFR axis in oral squamous cell carcinoma cellsČlánek Protocol development for discovery of angiogenesis inhibitors via automated methods using zebrafishČlánek Temporal weights in loudness: Investigation of the effects of background noise and sound levelČlánek Isolation and identification of an isoflavone reducing bacterium from feces from a pregnant horseČlánek The bacterial community in potato is recruited from soil and partly inherited across generationsČlánek Infective endocarditis and diabetes mellitus: Results from a single-center study from 1994 to 2017Článek The trajectory of patterns of light and sedentary physical activity among females, ages 14-23Článek Estimation of maize evapotraspiration under drought stress - A case study of Huaibei Plain, ChinaČlánek Honey bee microbiome associated with different hive and sample types over a honey production seasonČlánek Incidence of colorectal cancer in Eritrea: Data from the National Health Laboratory, 2011-2017Článek Dispersion of Legionella bacteria in atmosphere: A practical source location estimation methodČlánek Factors influencing bird-building collisions in the downtown area of a major North American cityČlánek Decreased retinal thickness in patients with Alzheimer’s disease is correlated with disease severityČlánek Moving system with action sport cameras: 3D kinematics of the walking and running in a large volumeČlánek High heat tolerance in plants from the Andean highlands: Implications for paramos in a warmer worldČlánek Impacts of risk and competition on the profitability of banks: Empirical evidence from PakistanČlánek Tributyltin chloride (TBT) induces RXRA down-regulation and lipid accumulation in human liver cellsČlánek Differences in clinical features of cluster headache between drinkers and nondrinkers in JapanČlánek Polo-like kinase 1 (Plk1) inhibition synergizes with taxanes in triple negative breast cancerČlánek Genome-wide SNP analyses reveal population structure of Portunus pelagicus along Vietnam coastlineČlánek Manipulating the odds: The effects of Machiavellianism and construal level on cheating behaviorČlánek Primary care in five European countries: A citizens’ perspective on the quality of care for childrenČlánek Overcoming platinum resistance in ovarian cancer by targeting pregnancy-associated plasma protein-AČlánek Capacity of the medullary cavity of tibia and femur for intra-bone marrow transplantation in miceČlánek Phylogenetic revision of Gymnotidae (Teleostei: Gymnotiformes), with descriptions of six subgeneraČlánek Hidden noise in immunologic parameters might explain rapid progression in early-onset periodontitisČlánek Identification of a novel monocytic phenotype in Classic Hodgkin Lymphoma tumor microenvironmentČlánek Binding and dynamics of melatonin at the interface of phosphatidylcholine-cholesterol membranesČlánek Retinoic acid-stimulated ERK1/2 pathway regulates meiotic initiation in cultured fetal germ cellsČlánek Gender disparities in scientific production: A nationwide assessment among physicians in PeruČlánek Study on the damage characteristics of gas-bearing shale under different unloading stress pathsČlánek Association of clinical factors with survival outcomes in laryngeal squamous cell carcinoma (LSCC)Článek Population preferences for breast cancer screening policies: Discrete choice experiment in BelarusČlánek Appropriate management of acute gastroenteritis in Australian children: A population-based studyČlánek More than just availability: Who has access and who administers take-home naloxone in Baltimore, MDČlánek Protein synthesis rates of muscle, tendon, ligament, cartilage, and bone tissue in vivo in humansČlánek Molecular characterisation of genital human papillomavirus among women in Southwestern, NigeriaČlánek Gene expression microarray public dataset reanalysis in chronic obstructive pulmonary diseaseČlánek Utility of the new cobas HCV test for viral load monitoring during direct-acting antiviral therapyČlánek Whole body periodic acceleration in normal and reduced mucociliary clearance of conscious sheepČlánek Minimal effects of oyster aquaculture on local water quality: Examples from southern Chesapeake BayČlánek Finding phrases: On the role of co-verbal facial information in learning word order in infancyČlánek Yeasts affect tolerance of Drosophila melanogaster to food substrate with high NaCl concentrationČlánek The effect of climate change on cholera disease: The road ahead using artificial neural networkČlánek Adaptive fuzzy flow rate control considering multifractal traffic modeling and 5G communicationsČlánek UM171 induces a homeostatic inflammatory-detoxification response supporting human HSC self-renewalČlánek Vaccine cold chain in general practices: A prospective study in 75 refrigerators (Keep Cool study)Článek Artificial insemination with fresh, liquid stored and frozen thawed semen in dromedary camelsČlánek Mammary microbiome of lactating organic dairy cows varies by time, tissue site, and infection statusČlánek An outbreak of tuberculosis in a middle school in Henan, China: Epidemiology and risk factorsČlánek Impact of UVC-sustained recirculating air filtration on airborne bacteria and dust in a pig facilityČlánek Pre-clinical medical student reflections on implicit bias: Implications for learning and teachingČlánek Foxtail millet (Setaria italica (L.) P. Beauv) CIPKs are responsive to ABA and abiotic stressesČlánek Calreticulin regulates vascular endothelial growth factor-A mRNA stability in gastric cancer cellsČlánek The association between haemoglobin levels in the first 20 weeks of pregnancy and pregnancy outcomesČlánek Factors associated with persistently high-cost health care utilization for musculoskeletal painČlánek Why men with a low-risk prostate cancer select and stay on active surveillance: A qualitative studyČlánek Imported severe malaria and risk factors for intensive care: A single-centre retrospective analysisČlánek Effectiveness of telerehabilitation in the management of adults with stroke: A systematic reviewČlánek Evaluation of neutral oral contrast agents for assessment of the small bowel at abdominal staging CTČlánek Determinants of mortality among patients with drug-resistant tuberculosis in northern NigeriaČlánek Effects of tetracycline on myocardial infarct size in obese rats with chemically-induced colitisČlánek Patient-level cost of home- and facility-based child pneumonia treatment in Suba Sub County, KenyaČlánek TAP: A static analysis model for PHP vulnerabilities based on token and deep learning technologyČlánek Time trends between 2002 and 2017 in correlates of self-reported sitting time in European adultsČlánek Establishment of the experimental procedure for prediction of conjugation capacity in mutant UGT1A1Článek The performance of practitioners conducting facial comparisons on images of children across ageČlánek Willingness to receive institutional and community-based eldercare among the rural elderly in ChinaČlánek Nonarteritic anterior ischemic optic neuropathy is associated with cerebral small vessel diseaseČlánek An evolution of socioeconomic related inequality in teenage pregnancy and childbearing in MalawiČlánek Migration and political polarization in the U.S.: An analysis of the county-level migration networkČlánek Retraction: Placental expression of CD100, CD72 and CD45 is dysregulated in human miscarriageČlánek Oxygen delivery, oxygen consumption and decreased kidney function after cardiopulmonary bypassČlánek Location, location, location: Close ties among older continuing care retirement community residentsČlánek Metabolic costs of spontaneous swimming in Sprattus sprattus L., at different water temperaturesČlánek Multiple innate antibacterial immune defense elements are correlated in diverse ungulate speciesČlánek First evidence of hepatitis E virus infection in a small mammal (yellow-necked mouse) from CroatiaČlánek Semantic computational analysis of anticoagulation use in atrial fibrillation from real world dataČlánek A mathematical model of honey bee colony dynamics to predict the effect of pollen on colony failureČlánek Socioeconomic determinants of cancer screening utilisation in Latin America: A systematic reviewČlánek Towards successful business process improvement – An extension of change acceleration process modelČlánek Correction: Intensive longitudinal modelling predicts diurnal activity of salivary alpha-amylaseČlánek HHIP overexpression inhibits the proliferation, migration and invasion of non-small cell lung cancerČlánek Research ethics in inter- and multi-disciplinary teams: Differences in disciplinary interpretationsČlánek A digital collection of rare and endangered lemurs and other primates from the Duke Lemur CenterČlánek The ZJU index is a powerful surrogate marker for NAFLD in severely obese North American womenČlánek Risk of temperature, humidity and concentrations of air pollutants on the hospitalization of AECOPDČlánek Influence of season and social context on male giant panda (Ailuropoda melanoleuca) vocal behaviour
Článok vyšiel v časopisePLOS One
Najčítanejšie tento týždeň
2019 Číslo 11- Metformin zlepšuje u žen se syndromem polycystických ovarií pravidelnost menstruačního cyklu i hormonální a metabolický profil
- Souvislost mezi autismem a ultrazvukovým vyšetřením v I. trimestru
- Somatizace stresu – typické projevy a možnosti řešení
- Nové antidotum pro xabany − andexanet alfa − na obzoru. Jaké zkušenosti vyplynuly ze studií?
- Když se ve střevech děje něco nepatřičného...
-
Všetky články tohto čísla
- Wild Steps in a semi-wild setting? Habitat selection and behavior of European bison reintroduced to an enclosure in an anthropogenic landscape
- The effect of facial expression on contrast sensitivity: A behavioural investigation and extension of Hedger, Adams & Garner (2015)
- Non-communicable diseases risk factors and their determinants: A cross-sectional state-wide STEPS survey, Haryana, North India
- Genotype-matched Newcastle disease virus vaccine confers improved protection against genotype XII challenge: The importance of cytoplasmic tails in viral replication and vaccine design
- Combined transcriptomics and proteomics forecast analysis for potential genes regulating the Columbian plumage color in chickens
- Persistence of traditional and emergence of new structural drivers and factors for the HIV epidemic in rural Uganda; A qualitative study
- Competency assessment of the medical interns and nurses and documenting prevailing practices to provide family planning services in teaching hospitals in three states of India
- Choice of birth place among antenatal clinic attendees in rural mission hospitals in Ebonyi State, South-East Nigeria
- Dual pathway for metabolic engineering of Escherichia coli to produce the highly valuable hydroxytyrosol
- Genetic and genomic analyses underpin the feasibility of concomitant genetic improvement of milk yield and mastitis resistance in dairy sheep
- Long-term exposure to daily ethanol injections in DBA/2J and Swiss mice: Lessons for the interpretation of ethanol sensitization
- Taxonomic and functional anuran beta diversity of a subtropical metacommunity respond differentially to environmental and spatial predictors
- A simple way to improve a conventional A/O-MBR for high simultaneous carbon and nutrient removal from synthetic municipal wastewater
- Knowledge and awareness of cervical cancer in Southwestern Ethiopia is lacking: A descriptive analysis
- Flat electrode contacts for vagus nerve stimulation
- Circulating Th17.1 cells as candidate for the prediction of therapeutic response to abatacept in patients with rheumatoid arthritis: An exploratory research
- Prevalence and socioeconomic determinants of development delay among children in Ceará, Brazil: A population-based study
- Characterizing macroinvertebrate community composition and abundance in freshwater tidal wetlands of the Sacramento-San Joaquin Delta
- A randomized controlled trial comparing isosorbide dinitrate-oxytocin versus misoprostol-oxytocin at management of foetal intrauterine death
- Hello, is that me you are looking for? A re-examination of the role of the DMN in social and self relevant aspects of off-task thought
- Lactobacillus rhamnosus Lcr35 as an effective treatment for preventing Candida albicans infection in the invertebrate model Caenorhabditis elegans: First mechanistic insights
- Use of latent class analysis to identify multimorbidity patterns and associated factors in Korean adults aged 50 years and older
- A study of psychological pain in substance use disorder and its relationship to treatment outcome
- Effects of artificially introduced Enterococcus faecalis strains in experimental necrotizing enterocolitis
- Treatment-seeking for vaginal fistula in sub-Saharan Africa
- Dissemination and stakeholder engagement practices among dissemination & implementation scientists: Results from an online survey
- Comparative analysis of the accelerated aged seed transcriptome profiles of two maize chromosome segment substitution lines
- Transactional sex among men who have sex with men participating in the CohMSM prospective cohort study in West Africa
- Addiction of mesenchymal phenotypes on the FGF/FGFR axis in oral squamous cell carcinoma cells
- Left parietal tACS at alpha frequency induces a shift of visuospatial attention
- Microtranscriptome analysis of sugarcane cultivars in response to aluminum stress
- The role of alien species on plant-floral visitor network structure in invaded communities
- Predictive factors for unfavourable treatment in MDR-TB and XDR-TB patients in Rio de Janeiro State, Brazil, 2000-2016
- Agricultural impacts on streams near Nitrate Vulnerable Zones: A case study in the Ebro basin, Northern Spain
- Development of a multi-locus typing scheme for an Enterobacteriaceae linear plasmid that mediates inter-species transfer of flagella
- The roles of MRI-based prostate volume and associated zone-adjusted prostate-specific antigen concentrations in predicting prostate cancer and high-risk prostate cancer
- Re-modeling of foliar membrane lipids in a seagrass allows for growth in phosphorus-deplete conditions
- Effect of sampling frequency on fractal fluctuations during treadmill walking
- Effect of calcium intake and the dietary cation-anion difference during early lactation on the bone mobilization dynamics throughout lactation in dairy cows
- Facilitators and barriers to linkage to HIV care and treatment among female sex workers in a community-based HIV prevention intervention in Tanzania: A qualitative study
- Tuberculosis treatment outcome: The case of women in Ethiopia and China, ten-years retrospective cohort study
- Protein:Protein interactions in the cytoplasmic membrane apparently influencing sugar transport and phosphorylation activities of the e. coli phosphotransferase system
- A digital collection of rare and endangered lemurs and other primates from the Duke Lemur Center
- Computational fluid dynamics simulation of changes in the morphology and airflow dynamics of the upper airways in OSAHS patients after treatment with oral appliances
- Resistome metagenomics from plate to farm: The resistome and microbial composition during food waste feeding and composting on a Vermont poultry farm
- Lower limb chronic edema management program: Perspectives of disengaged patients on challenges, enablers and barriers to program attendance and adherence
- Discovery of powdery mildew resistance gene candidates from Aegilops biuncialis chromosome 2Mb based on transcriptome sequencing
- Modelling vegetation understory cover using LiDAR metrics
- Assessing the impact of the “one-child policy” in China: A synthetic control approach
- CRISPR-Cas9 modified bacteriophage for treatment of Staphylococcus aureus induced osteomyelitis and soft tissue infection
- Forecasting type-specific seasonal influenza after 26 weeks in the United States using influenza activities in other countries
- Chronic exercise modulates the cellular immunity and its cannabinoid receptors expression
- Characterization of the diverse plasmid pool harbored by the blaNDM-1-containing Acinetobacter bereziniae HPC229 clinical strain
- What does mitogenomics tell us about the evolutionary history of the Drosophila buzzatii cluster (repleta group)?
- A cell-based evaluation of a non-essential amino acid formulation as a non-bioactive control for activation and stimulation of muscle protein synthesis using ex vivo human serum
- Conjugated linoleic acid as a novel insecticide targeting the agricultural pest Leptinotarsa decemlineata
- Relationship between pattern electroretinogram and optic disc morphology in glaucoma
- Depicting changes in land surface cover at Al-Hassa oasis of Saudi Arabia using remote sensing and GIS techniques
- Land snail dispersal, abundance and diversity on green roofs
- Fanconi-BRCA pathway mutations in childhood T-cell acute lymphoblastic leukemia
- Mesenchymal Stem/ Stromal Cells metabolomic and bioactive factors profiles: A comparative analysis on the umbilical cord and dental pulp derived Stem/ Stromal Cells secretome
- The association between caesarean section delivery and later life obesity in 21-24 year olds in an Urban South African birth cohort
- Diagnosis and treatment of acute respiratory illness in children under five in primary care in low-, middle-, and high-income countries: A descriptive FRESH AIR study
- Quality control of cervical cytology using a 3-type HPV mRNA test increases screening program sensitivity of cervical intraepithelial neoplasia grade 2+ in young Norwegian women—A cohort study
- Toxicity and sublethal effects of two plant allelochemicals on the demographical traits of cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae)
- Protocol development for discovery of angiogenesis inhibitors via automated methods using zebrafish
- Friends with malefit. The effects of keeping dogs and cats, sustaining animal-related injuries and Toxoplasma infection on health and quality of life
- Trueness of digital intraoral impression in reproducing multiple implant position
- Comparison of drug safety data obtained from the monitoring system, literature, and social media: An empirical proof from a Chinese patent medicine
- Norm values and psychometric properties of the short version of the Trier Inventory for Chronic Stress (TICS) in a representative German sample
- Maternal health and birth outcomes in a South African birth cohort study
- Structural characterization of scorpion peptides and their bactericidal activity against clinical isolates of multidrug-resistant bacteria
- Molecular evolution of genes encoding allergen proteins in the peanuts genus Arachis: Structural and functional implications
- Structural characterization of the saxitoxin-targeting APTSTX1 aptamer using optical tweezers and molecular dynamics simulations
- Residential household yard care practices along urban-exurban gradients in six climatically-diverse U.S. metropolitan areas
- Formal comment on “Assessing the impact of the ‘one-child policy’ in China: A synthetic control approach”
- Evaluation of a global spring wheat panel for stripe rust: Resistance loci validation and novel resources identification
- “Big men” in the office: The gender-specific influence of weight upon persuasiveness
- Modification of everyday activities and its association with self-awareness in cognitively diverse older adults
- The effect of bivalve filtration on eDNA-based detection of aquatic organisms
- Selective culture enrichment and sequencing of feces to enhance detection of antimicrobial resistance genes in third-generation cephalosporin resistant Enterobacteriaceae
- Development and validation of rapid environmental DNA (eDNA) detection methods for bog turtle (Glyptemys muhlenbergii)
- Average and time-specific maternal prenatal inflammatory biomarkers and the risk of labor epidural associated fever
- Preference-based measure of health-related quality of life and its determinants in sickle cell disease in Nigeria
- Factors influencing participation dynamics in research for development interventions with multi-stakeholder platforms: A metric approach to studying stakeholder participation
- Contextual variation in young children’s acquisition of social-emotional skills
- Prokaryotic and eukaryotic microbiomes associated with blooms of the ichthyotoxic dinoflagellate Cochlodinium (Margalefidinium) polykrikoides in New York, USA, estuaries
- Reconciling the statistics of spectral reflectance and colour
- Temporal weights in loudness: Investigation of the effects of background noise and sound level
- A global assessment of street-network sprawl
- Correction: KRIT1 Regulates the Homeostasis of Intracellular Reactive Oxygen Species
- Mindfulness-Based Blood Pressure Reduction (MB-BP): Stage 1 single-arm clinical trial
- Measurement of abortion safety using community-based surveys: Findings from three countries
- Behavioral response of naïve and non-naïve deer to wolf urine
- SNARE proteins rescue impaired autophagic flux in Down syndrome
- Negative impact of gestational diabetes mellitus on progress of pelvic floor muscle electromyography activity: Cohort study
- Change in left inferior frontal connectivity with less unexpected harmonic cadence by musical expertise
- Structural mechanism for regulation of DNA binding of BpsR, a Bordetella regulator of biofilm formation, by 6-hydroxynicotinic acid
- How does open innovation lead competitive advantage? A dynamic capability view perspective
- Bull efficiency using dairy genetic traits
- Improved cortical boundary registration for locally distorted fMRI scans
- Extractive single document summarization using binary differential evolution: Optimization of different sentence quality measures
- Measuring the tilt and slant of Chinese handwriting in primary school students: A computerized approach
- Isolation and identification of an isoflavone reducing bacterium from feces from a pregnant horse
- Sugar labeling: How numerical information of sugar content influences healthiness and tastiness expectations
- Optimally adjusted last cluster for prediction based on balancing the bias and variance by bootstrapping
- Quantifying normal and parkinsonian gait features from home movies: Practical application of a deep learning–based 2D pose estimator
- Heterogeneity of porcine bone marrow-derived dendritic cells induced by GM-CSF
- Can visual interpretation of NucliSens graphs reduce the need for repeat viral load testing?
- Manganese levels in infant formula and young child nutritional beverages in the United States and France: Comparison to breast milk and regulations
- Association between metabolic body composition status and risk for impaired renal function: A cross-sectional study
- Toddler skills predict moderate-to-late preterm born children’s cognition and behaviour at 6 years of age
- The bacterial community in potato is recruited from soil and partly inherited across generations
- Infective endocarditis and diabetes mellitus: Results from a single-center study from 1994 to 2017
- Patient satisfaction with HIV services in Vietnam: Status, service models and association with treatment outcome
- Ion concentration polarization (ICP) of proteins at silicon micropillar nanogaps
- The trajectory of patterns of light and sedentary physical activity among females, ages 14-23
- Coadministration of kla peptide with HPRP-A1 to enhance anticancer activity
- Measuring the complexity of directed graphs: A polynomial-based approach
- Estimation of maize evapotraspiration under drought stress - A case study of Huaibei Plain, China
- Publication rates in animal research. Extent and characteristics of published and non-published animal studies followed up at two German university medical centres
- Developmental conservation of microRNA gene localization at the nuclear periphery
- Exploring critical factors of the perceived usefulness of blended learning for higher education students
- Anti-Alzheimer potential, metabolomic profiling and molecular docking of green synthesized silver nanoparticles of Lampranthus coccineus and Malephora lutea aqueous extracts
- Protective effect of Platymiscium floribundum Vog. in tree extract on periodontitis inflammation in rats
- Direct transport vs secondary transfer to level I trauma centers in a French exclusive trauma system: Impact on mortality and determinants of triage on road-traffic victims
- Honey bee microbiome associated with different hive and sample types over a honey production season
- Bacterial communities in the rhizosphere, phyllosphere and endosphere of tomato plants
- Sildenafil citrate long-term treatment effects on cardiovascular reactivity in a SHR experimental model of metabolic syndrome
- Postoperative delirium after lung resection for primary lung cancer: Risk factors, risk scoring system, and prognosis
- The CSF-1-receptor inhibitor, JNJ-40346527 (PRV-6527), reduced inflammatory macrophage recruitment to the intestinal mucosa and suppressed murine T cell mediated colitis
- Using Er:YAG laser to remove lithium disilicate crowns from zirconia implant abutments: An in vitro study
- Antibacterial efficacy of cold atmospheric plasma against Enterococcus faecalis planktonic cultures and biofilms in vitro
- Mechanisms of African swine fever virus pathogenesis and immune evasion inferred from gene expression changes in infected swine macrophages
- Application of ensemble methods to analyse the decline of organochlorine pesticides in relation to the interactions between age, gender and time
- Mitogenomic diversity in Sacred Ibis Mummies sheds light on early Egyptian practices
- Automated detection of a nonperfusion area caused by retinal vein occlusion in optical coherence tomography angiography images using deep learning
- Characterisation of a novel SCCmec VI element harbouring fusC in an emerging Staphylococcus aureus strain from the Arabian Gulf region
- Inducible UCP1 silencing: A lentiviral RNA-interference approach to quantify the contribution of beige fat to energy homeostasis
- iCrotoK-PseAAC: Identify lysine crotonylation sites by blending position relative statistical features according to the Chou’s 5-step rule
- Emerging practices supporting diabetes self-management among food insecure adults and families: A scoping review
- Does aneurysm side influence the infarction side and patients´ outcome after subarachnoid hemorrhage?
- Raising the bar: Recovery ambition for species at risk in Canada and the US
- Management of locally advanced non-small cell lung cancer in the modern era: A national Italian survey on diagnosis, treatment and multidisciplinary approach
- Foraging strategies are maintained despite workforce reduction: A multidisciplinary survey on the pollen collected by a social pollinator
- Incidence of colorectal cancer in Eritrea: Data from the National Health Laboratory, 2011-2017
- Integrated analysis of miRNA landscape and cellular networking pathways in stage-specific prostate cancer
- Evaluation of the reactogenicity, adjuvanticity and antigenicity of LT(R192G) and LT(R192G/L211A) by intradermal immunization in mice
- Role of rhesus macaque IFITM3(2) in simian immunodeficiency virus infection of macaques
- Variation in the LRR region of Pi54 protein alters its interaction with the AvrPi54 protein revealed by in silico analysis
- Evolutionarily conserved susceptibility of the mitochondrial respiratory chain to SDHI pesticides and its consequence on the impact of SDHIs on human cultured cells
- Statistical determination of synergy based on Bliss definition of drugs independence
- The association between sleep problems and academic performance in primary school-aged children: Findings from a Norwegian longitudinal population-based study
- Estimating the national cost burden of in-hospital needlestick injuries among healthcare workers in Japan
- Assessing reliability of intra-tumor heterogeneity estimates from single sample whole exome sequencing data
- Dispersion of Legionella bacteria in atmosphere: A practical source location estimation method
- Integrative proteomic and phosphoproteomic profiling of prostate cell lines
- Treatment paths for localised prostate cancer in Italy: The results of a multidisciplinary, observational, prospective study (Pros-IT CNR)
- Why are undergraduate emerging adults anxious and avoidant in their romantic relationships? The role of family relationships
- Barriers to implementation of emergency obstetric and neonatal care in rural Pakistan
- Testosterone supplementation improves insulin responsiveness in HFD fed male T2DM mice and potentiates insulin signaling in the skeletal muscle and C2C12 myocyte cell line
- Ang-(1-7)/ MAS1 receptor axis inhibits allergic airway inflammation via blockade of Src-mediated EGFR transactivation in a murine model of asthma
- Factors influencing bird-building collisions in the downtown area of a major North American city
- Collembola laterally move biochar particles
- Decreased retinal thickness in patients with Alzheimer’s disease is correlated with disease severity
- Moving system with action sport cameras: 3D kinematics of the walking and running in a large volume
- Factors influencing subclinical atherosclerosis in patients with biopsy-proven nonalcoholic fatty liver disease
- Boundary violations and adolescent drinking: Observational evidence that symbolic boundaries moderate social influence
- Inadequate conflict of interest policies at most French teaching hospitals: A survey and website analysis
- A new resolution function to evaluate tree shape statistics
- Thermostat wars? The roles of gender and thermal comfort negotiations in household energy use behavior
- Patients undergoing surgery for lumbar spinal stenosis experience unique courses of pain and disability: A group-based trajectory analysis
- Lifetime prevalence of intimate partner violence against women in an urban Brazilian city: A cross-sectional survey
- The factors associated with being left-behind children in China: Multilevel analysis with nationally representative data
- High heat tolerance in plants from the Andean highlands: Implications for paramos in a warmer world
- Quantifying pediatric patient need for second- and third-line HIV treatment: A tool for decision-making in resource-limited settings
- Discovery of actionable genetic alterations with targeted panel sequencing in children with relapsed or refractory solid tumors
- Iodine status of non-pregnant women and availability of food vehicles for fortification with iodine in a remote community in Gulf province, Papua New Guinea
- Fibre and extracellular matrix contributions to passive forces in human skeletal muscles: An experimental based constitutive law for numerical modelling of the passive element in the classical Hill-type three element model
- The status of imported Barremian-Bedoulian flint in north-eastern Iberia during the Middle Neolithic. Insights from the variscite mines of Gavà (Barcelona)
- Psychology of personal data donation
- Radiocarbon dating and cultural dynamics across Mongolia’s early pastoral transition
- MARGO (Massively Automated Real-time GUI for Object-tracking), a platform for high-throughput ethology
- Visual detection of time-varying signals: Opposing biases and their timescales
- Results from a World Health Organization pilot of the Basic Emergency Care Course in Sub Saharan Africa
- Scientists’ opinions and attitudes towards citizens’ understanding of science and their role in public engagement activities
- Dacentrurine stegosaurs (Dinosauria): A new specimen of Miragaia longicollum from the Late Jurassic of Portugal resolves taxonomical validity and shows the occurrence of the clade in North America
- Integrated pan-cancer gene expression and drug sensitivity analysis reveals SLFN11 mRNA as a solid tumor biomarker predictive of sensitivity to DNA-damaging chemotherapy
- Does membrane feeding compromise the quality of Aedes aegypti mosquitoes?
- Morphology, phylogeny, and taxonomy of two species of colonial volvocine green algae from Lake Victoria, Tanzania
- Metabolomics profiles associated with HbA1c levels in patients with type 2 diabetes
- Exploring local realities: Perceptions and experiences of healthcare workers on the management and control of drug-resistant tuberculosis in Addis Ababa, Ethiopia
- Sex differences in the treatment and outcome of emergency general surgery
- Comorbidities and costs in HIV patients: A retrospective claims database analysis in Germany
- Barriers to integration of bioinformatics into undergraduate life sciences education: A national study of US life sciences faculty uncover significant barriers to integrating bioinformatics into undergraduate instruction
- Local unemployment changes the springboard effect of low pay: Evidence from England
- A comparison of body composition assessment methods in climbers: Which is better?
- Comparison of an in-house ‘home-brew’ and commercial ViroSeq integrase genotyping assays on HIV-1 subtype C samples
- Elucidating genetic variability and population structure in Venturia inaequalis associated with apple scab diseaseusing SSR markers
- Clustering via hypergraph modularity
- Indomethacin enhances anti-tumor efficacy of a MUC1 peptide vaccine against breast cancer in MUC1 transgenic mice
- Multistage fuzzy comprehensive evaluation of landslide hazards based on a cloud model
- Inducible microRNA-200c decreases motility of breast cancer cells and reduces filamin A
- Pharmacological signatures of the reduced incidence and the progression of cognitive decline in ageing populations suggest the protective role of beneficial polypharmacy
- Continuous influenza virus production in a tubular bioreactor system provides stable titers and avoids the “von Magnus effect”
- Complex interaction networks of cytokines after transarterial chemotherapy in patients with hepatocellular carcinoma
- Gender essentialism in transgender and cisgender children
- Insertional mutagenesis in the zoonotic pathogen Chlamydia caviae
- Being there: A scoping review of grief support training in medical education
- Does the psychological profile influence the position of promising young futsal players?
- Effect of self-rated health status on functioning difficulties among older adults in Ghana: Coarsened exact matching method of analysis of the World Health Organization’s study on global AGEing and adult health, Wave 2
- Olfactory screening of Parkinson’s Disease patients and healthy subjects in China and Germany: A study of cross-cultural adaptation of the Sniffin’ Sticks 12-identification test
- Molecular evolution of cytochrome C oxidase-I protein of insects living in Saudi Arabia
- Correlates of leisure-time sedentary behavior among 181,793 adolescents aged 12-15 years from 66 low- and middle-income countries
- Cost-effectiveness analysis of Mucosal Leishmaniasis diagnosis with PCR-based vs parasitological tests in Colombia
- Spatiotemporal analysis of historical records (2001–2012) on dengue fever in Vietnam and development of a statistical model for forecasting risk
- Resilience assessment of Puerto Rico’s coral reefs to inform reef management
- Effect of community based health education on knowledge and attitude towards iron and folic acid supplementation among pregnant women in Kiambu County, Kenya: A quasi experimental study
- Implementation and effectiveness of non-specialist mediated interventions for children with Autism Spectrum Disorder: A systematic review and meta-analysis
- A tailored cognitive behavioral program for juvenile justice-referred females at risk of substance use and delinquency: A pilot quasi-experimental trial
- Impact of adjusted kidney volume measured in the bench surgery on one-year renal function in kidney transplantation
- Machine learning algorithm validation with a limited sample size
- The magnitude of suicidal ideation, attempts and associated factors of HIV positive youth attending ART follow ups at St. Paul’s hospital Millennium Medical College and St. Peter’s specialized hospital, Addis Ababa, Ethiopia, 2018
- The nonlinear effect of financial and fiscal policies on poverty alleviation in China—An empirical analysis of Chinese 382 impoverished counties with PSTR models
- Impacts of risk and competition on the profitability of banks: Empirical evidence from Pakistan
- Molecular characterization of lung adenocarcinoma from Korean patients using next generation sequencing
- An expansin-like protein expands forage cell walls and synergistically increases hydrolysis, digestibility and fermentation of livestock feeds by fibrolytic enzymes
- Joint image compression and encryption based on sparse Bayesian learning and bit-level 3D Arnold cat maps
- Urticating setae of tarantulas (Araneae: Theraphosidae): Morphology, revision of typology and terminology and implications for taxonomy
- Live observation of the oviposition process in Daphnia magna
- On the accuracy of displacement-based wave intensity analysis: Effect of vessel wall viscoelasticity and nonlinearity
- Nodosilinea signiensis sp. nov. (Leptolyngbyaceae, Synechococcales), a new terrestrial cyanobacterium isolated from mats collected on Signy Island, South Orkney Islands, Antarctica
- A 3’ UTR SNP rs885863, a cis-eQTL for the circadian gene VIPR2 and lincRNA 689, is associated with opioid addiction
- Characterizing the Randot Preschool stereotest: Testability, norms, reliability, specificity and sensitivity in children aged 2-11 years
- Tributyltin chloride (TBT) induces RXRA down-regulation and lipid accumulation in human liver cells
- Amazon climatic factors driving terpene composition of Iryanthera polyneura Ducke in terra-firme forest: A statistical approach
- Differences in clinical features of cluster headache between drinkers and nondrinkers in Japan
- Distribution of macular ganglion cell layer thickness in foveal hypoplasia: A new diagnostic criterion for ocular albinism
- Polo-like kinase 1 (Plk1) inhibition synergizes with taxanes in triple negative breast cancer
- Effect of mechanochemical activation of natural phosphorite structure as well as phosphorus solubility
- Automated content analysis across six languages
- A deep learning reconstruction framework for X-ray computed tomography with incomplete data
- Integrating interconception care in preventive child health care services: The Healthy Pregnancy 4 All program
- The prognostic significance of tumor-infiltrating lymphocytes assessment with hematoxylin and eosin sections in resected primary lung adenocarcinoma
- Effectiveness of novel fabrics to resist punctures and lacerations from white shark (Carcharodon carcharias): Implications to reduce injuries from shark bites
- Bacillus Calmette-Guérin (BCG) therapy lowers the incidence of Alzheimer’s disease in bladder cancer patients
- Serial block-face scanning electron microscopy reveals neuronal-epithelial cell fusion in the mouse cornea
- Salt or fish (or salted fish)? The Bronze Age specialised sites along the Tyrrhenian coast of Central Italy: New insights from Caprolace settlement
- Pragmatic language dysfunction in systemic lupus erythematosus patients: Results from a single center Italian study
- Association between cerebral atrophy and osteoporotic vertebral compression fractures
- Latitudinal gradient of cyanobacterial diversity in tidal flats
- Gene expression based survival prediction for cancer patients—A topic modeling approach
- Understanding allergic multimorbidity within the non-eosinophilic interactome
- The association between psychological distress and angina pectoris: A population-based study
- Comparative analysis on Facebook post interaction using DNN, ELM and LSTM
- Cerebellum-mediated trainability of eye and head movements for dynamic gazing
- Psychological and physiological effects of applying self-control to the mobile phone
- Omecamtiv mecarbil lowers the contractile deficit in a mouse model of nebulin-based nemaline myopathy
- Genome-wide SNP analyses reveal population structure of Portunus pelagicus along Vietnam coastline
- Modulating transcription through development of semi-synthetic yeast core promoters
- Left-handed metamaterial bandpass filter for GPS, Earth Exploration-Satellite and WiMAX frequency sensing applications
- Cost-effectiveness analysis of PSA-based mass screening: Evidence from a randomised controlled trial combined with register data
- A good tennis player does not lose matches. The effects of valence congruency in processing stance-argument pairs
- Validation of the group tasks uncertainty model (MITAG) in a German sample
- Parent psychological wellbeing in a single-family room versus an open bay neonatal intensive care unit
- Optimizing the procedure of grain nutrient predictions in barley via hyperspectral imaging
- In-situ time resolved spectrographic measurement using an additively manufactured metallic micro-fluidic analysis platform
- Race disparity in blood sphingolipidomics associated with lupus cardiovascular comorbidity
- Characterization of the placental transcriptome through mid to late gestation in the mare
- Indirect violence exposure and mental health symptoms among an urban public-school population: Prevalence and correlates
- Diagnostic ability of multifocal electroretinogram in early multiple sclerosis using a new signal analysis method
- Predictors of never having a mammogram among Chinese, Vietnamese, and Korean immigrant women in the U.S.
- The impact of hepatic steatosis on portal hypertension
- How do and could clinical guidelines support patient-centred care for women: Content analysis of guidelines
- Study of the epidemiological behavior of malaria in the Darien Region, Panama. 2015–2017
- School-based obesity prevention for busy low-income families—Organisational and personal barriers and facilitators to implementation
- Neighborhood crime, disorder and substance use in the Caribbean context: Jamaica National Drug Use Prevalence Survey 2016
- Genomic comparison of diverse Salmonella serovars isolated from swine
- Significance of the lobe-specific emphysema index to predict prolonged air leak after anatomical segmentectomy
- Modeling of inter-organizational coordination dynamics in resilience planning of infrastructure systems: A multilayer network simulation framework
- Manipulating the odds: The effects of Machiavellianism and construal level on cheating behavior
- Early recognition of anorexia through patient-generated assessment predicts survival in patients with oesophagogastric cancer
- Identifying publications in questionable journals in the context of performance-based research funding
- ITGAM is a risk factor to systemic lupus erythematosus and possibly a protection factor to rheumatoid arthritis in patients from Mexico
- Nurses’ and patients’ experiences and preferences of the ankle-brachial pressure index and multi-site photoplethysmography for the diagnosis of peripheral arterial disease: A qualitative study
- Cluster tendency assessment in neuronal spike data
- Voluntary medical male circumcision for HIV prevention among adolescents in Kenya: Unintended consequences of pursuing service-delivery targets
- Primary care in five European countries: A citizens’ perspective on the quality of care for children
- High Order Profile Expansion to tackle the new user problem on recommender systems
- Psychometric properties of the Korean version of the Health Literacy on Social Determinants of Health Questionnaire (K-HL-SDHQ)
- Flood hazard mapping and assessment in data-scarce Nyaungdon area, Myanmar
- Methods for the identification of farm escapees in feral mink (Neovison vison) populations
- Transcriptional analysis of amino acid, metal ion, vitamin and carbohydrate uptake in butanol-producing Clostridium beijerinckii NRRL B-598
- Long-term vancomycin use had low risk of ototoxicity
- Overcoming platinum resistance in ovarian cancer by targeting pregnancy-associated plasma protein-A
- Exploration of muscle loss and metabolic state during prolonged critical illness: Implications for intervention?
- Pan-caspase inhibitor F573 mitigates liver ischemia reperfusion injury in a murine model
- Efficacy of interleukin 10 gene hydrofection in pig liver vascular isolated ‘in vivo’ by surgical procedure with interest in liver transplantation
- Molecular characteristics of segment 5, a unique fragment encoding two partially overlapping ORFs in the genome of rice black-streaked dwarf virus
- Early economic evaluation of MRI-guided laser interstitial thermal therapy (MRgLITT) and epilepsy surgery for mesial temporal lobe epilepsy
- GLADS: A gel-less approach for detection of STMS markers in wheat and rice
- Anterior tooth-use behaviors among early modern humans and Neandertals
- Incidence patterns of orofacial clefts in purebred dogs
- Capacity of the medullary cavity of tibia and femur for intra-bone marrow transplantation in mice
- Association of thoracic spine deformity and cardiovascular disease in a mouse model for Marfan syndrome
- Predicting atrial fibrillation in primary care using machine learning
- M3VR—A multi-stage, multi-resolution, and multi-volumes-of-interest volume registration method applied to 3D endovaginal ultrasound
- A developmental trajectory supporting the evaluation and achievement of competencies: Articulating the Mastery Rubric for the nurse practitioner (MR-NP) program curriculum
- Mobile medication manager application to improve adherence with immunosuppressive therapy in renal transplant recipients: A randomized controlled trial
- Default Mode Network structural alterations in Kocher-Monro trajectory white matter transection: A 3 and 7 tesla simulation modeling approach
- Phylogenetic revision of Gymnotidae (Teleostei: Gymnotiformes), with descriptions of six subgenera
- Population genetic analysis of 36 Y-chromosomal STRs yields comprehensive insights into the forensic features and phylogenetic relationship of Chinese Tai-Kadai-speaking Bouyei
- Prevention of suicidal behaviour: Results of a controlled community-based intervention study in four European countries
- An assessment of khat consumption habit and its linkage to household economies and work culture: The case of Harar city
- Fixation of genetic variation and optimization of gene expression: The speed of evolution in isolated lizard populations undergoing Reverse Island Syndrome
- One simple claudication question as first step in Peripheral Arterial Disease (PAD) screening: A meta-analysis of the association with reduced Ankle Brachial Index (ABI) in 27,945 subjects
- Direct cost of health care for individuals with community associated Clostridium difficile infections: A population-based cohort study
- Association between serum homocysteine level and cognitive function in middle-aged type 2 diabetes mellitus patients
- A qualitative research synthesis of contextual factors contributing to female overweight and obesity over the life course in sub-Saharan Africa
- Insight into the relationship between aryl-hydrocarbon receptor and β-catenin in human colon cancer cells
- Hidden noise in immunologic parameters might explain rapid progression in early-onset periodontitis
- The role of stigma in the acceptance and disclosure of HIV among recently diagnosed men who have sex with men in Australia: A qualitative study
- Detection of Schistosoma japonicum and Oncomelania hupensis quadrasi environmental DNA and its potential utility to schistosomiasis japonica surveillance in the Philippines
- Does age influence the quality of life in children with atopic dermatitis?
- Questioning the lasting effect of galvanic vestibular stimulation on postural control
- Identification of a novel monocytic phenotype in Classic Hodgkin Lymphoma tumor microenvironment
- Characterization of 20 complete plastomes from the tribe Laureae (Lauraceae) and distribution of small inversions
- Binding and dynamics of melatonin at the interface of phosphatidylcholine-cholesterol membranes
- Recent climate-driven ecological change across a continent as perceived through local ecological knowledge
- Nonalcoholic fatty liver disease is an early predictor of metabolic diseases in a metabolically healthy population
- Occurrence and multilocus genotyping of Giardia duodenalis from post-weaned dairy calves in Sichuan province, China
- Retinoic acid-stimulated ERK1/2 pathway regulates meiotic initiation in cultured fetal germ cells
- Gender disparities in scientific production: A nationwide assessment among physicians in Peru
- Effect of F1 and F2 generations on genetic variability and working steps of doubled haploid production in maize
- Mitochondrial dysfunction in rheumatoid arthritis: A comprehensive analysis by integrating gene expression, protein-protein interactions and gene ontology data
- A caspase-6-cleaved fragment of Glial Fibrillary Acidic Protein as a potential serological biomarker of CNS injury after cardiac arrest
- A handy method to remove bacterial contamination from fungal cultures
- The self-care profiles and its determinants among adults with hypertension in primary health care clinics in Selangor, Malaysia
- The mutational landscape of quinolone resistance in Escherichia coli
- Exploring the influence of self-perceptions on the relationship between motor competence and identity in adolescents
- Study on the damage characteristics of gas-bearing shale under different unloading stress paths
- EPILAT-IRA Study: A contribution to the understanding of the epidemiology of acute kidney injury in Latin America
- 16S rDNA droplet digital PCR for monitoring bacterial DNAemia in bloodstream infections
- Three-dimensional (3D) brain microphysiological system for organophosphates and neurochemical agent toxicity screening
- Diversity of endocervical microbiota associated with genital Chlamydia trachomatis infection and infertility among women visiting obstetrics and gynecology clinics in Malaysia
- Health impact of hepatic-venous-occlusive disease in a small town in Ethiopia—Case study from Tahtay koraro district in Tigray region, 2017
- Development of a novel automatable fabrication method based on electrospinning co electrospraying for rotator cuff augmentation patches
- Development of a quantitative PCR assay for the detection and enumeration of a potentially ciguatoxin-producing dinoflagellate, Gambierdiscus lapillus (Gonyaulacales, Dinophyceae)
- Association of clinical factors with survival outcomes in laryngeal squamous cell carcinoma (LSCC)
- Seasonal oyster harvesting recorded in a Late Archaic period shell ring
- Population preferences for breast cancer screening policies: Discrete choice experiment in Belarus
- Respiratory health and inflammatory markers - Exposure to respirable dust and quartz and chemical binders in Swedish iron foundries
- Trends and predictors of mother-to-child transmission of HIV in an era of protocol changes: Findings from two large health facilities in North East Nigeria
- Elevated Ki-67 (MIB-1) expression as an independent predictor for unfavorable pathologic outcomes and biochemical recurrence after radical prostatectomy in patients with localized prostate cancer: A propensity score matched study
- Genome-wide identification and gene expression analysis of SOS family genes in tuber mustard (Brassica juncea var. tumida)
- Carvedilol improves glucose tolerance and insulin sensitivity in treatment of adrenergic overdrive in high fat diet-induced obesity in mice
- Institutional differences in USMLE Step 1 and 2 CK performance: Cross-sectional study of 89 US allopathic medical schools
- Molecular epidemiological characteristics of dengue virus carried by 34 patients in Guangzhou in 2018
- Heteroplasmy in the complete chicken mitochondrial genome
- Candida blood stream infections observed between 2011 and 2016 in a large Italian University Hospital: A time-based retrospective analysis on epidemiology, biofilm production, antifungal agents consumption and drug-susceptibility
- Sixty years since the creation of Lake Kariba: Thermal and oxygen dynamics in the riverine and lacustrine sub-basins
- Association of uric acid in serum and urine with subclinical renal damage: Hanzhong Adolescent Hypertension Study
- Appropriate management of acute gastroenteritis in Australian children: A population-based study
- The plasma metabolome of women in early pregnancy differs from that of non-pregnant women
- Effectiveness of four types of neuraminidase inhibitors approved in Japan for the treatment of influenza
- More than just availability: Who has access and who administers take-home naloxone in Baltimore, MD
- Evaluating the cross-cultural validity of the Dutch version of the Social Exclusion Index for Health Surveys (SEI-HS): A mixed methods study
- Diminuendo al bottom—Clarifying the semantics of music notation by re-modeling
- Structural analysis of the manganese transport regulator MntR from Bacillus halodurans in apo and manganese bound forms
- Serum uromodulin is associated with the severity of clinicopathological findings in ANCA-associated glomerulonephritis
- Male support for cervical cancer screening and treatment in rural Ghana
- ADAPTS: Automated deconvolution augmentation of profiles for tissue specific cells
- Comparison of shape quantification methods for genomic prediction, and genome-wide association study of sorghum seed morphology
- An attempt to identify the issues underlying the lack of consistent conceptualisations in the field of student mathematics-related beliefs
- Video abstracts and plain language summaries are more effective than graphical abstracts and published abstracts
- Trophic structure of the macrofauna associated to deep-vents of the southern Gulf of California: Pescadero Basin and Pescadero Transform Fault
- Incomplete insertion of pedicle screws in a standard construct reduces the fatigue life: A biomechanical analysis
- Cost savings associated with timely treatment of botulism with botulism antitoxin heptavalent product
- Effects of light and nitrogen availability on photosynthetic efficiency and fatty acid content of three original benthic diatom strains
- Early signal detection of adverse events following influenza vaccination using proportional reporting ratio, Victoria, Australia
- Bioinformatic analysis of a novel Echinococcus granulosus nuclear receptor with two DNA binding domains
- Genome-wide identification and characterization, phylogenetic comparison and expression profiles of SPL transcription factor family in B. juncea (Cruciferae)
- Hypoxia inhibits TNF-α-induced TSLP expression in keratinocytes
- Conceptualising alcohol consumption in relation to long-term health conditions: Exploring risk in interviewee accounts of drinking and taking medications
- Elevated interleukin-25 and its association to Th2 cytokines in systemic lupus erythematosus with lupus nephritis
- Thrombocytopenia and thrombocytosis are associated with different outcome in atrial fibrillation patients on anticoagulant therapy
- Involvement of extracellular vesicles in the macrophage-tumor cell communication in head and neck squamous cell carcinoma
- Comparison of Humphrey Field Analyzer and imo visual field test results in patients with glaucoma and pseudo-fixation loss
- Out-of-pocket expenditure and catastrophic health expenditure for hospitalization due to injuries in public sector hospitals in North India
- Concurrent validity and discriminative ability of Dutch performance-based motor tests in 5 to 6 years old children
- Cumulative viral load as a predictor of CD4+ T-cell response to antiretroviral therapy using Bayesian statistical models
- Can General Practitioners manage mental disorders in primary care? A partially randomised, pragmatic, cluster trial
- Self-serving incentives impair collective decisions by increasing conformity
- Mutation and immune profiling of metaplastic breast cancer: Correlation with survival
- The clinicopathological significance of Thrombospondin-4 expression in the tumor microenvironment of gastric cancer
- Propofol-based total intravenous anesthesia did not improve survival compared to desflurane anesthesia in breast cancer surgery
- Association between ossification of the posterior longitudinal ligament and ossification of the nuchal ligament in the cervical spine
- Effects of Debaryomyces hansenii treatment on intestinal mucosa microecology in mice with antibiotic-associated diarrhea
- Molecular validation of clinical Pantoea isolates identified by MALDI-TOF
- A novel wheat lodging resistance evaluation method and device based on the thrust force of the stalks
- Evolution of high tooth replacement rates in theropod dinosaurs
- Outpatient facility-based order variation in combined imaging
- Ethnic-racial identity affirmation: Validation in Aboriginal Australian children
- Non-intubated anesthesia in patients undergoing video-assisted thoracoscopic surgery: A systematic review and meta-analysis
- Tissue-type plasminogen activator selectively inhibits multiple toll-like receptors in CSF-1-differentiated macrophages
- Changes of serum pentraxin-3 and hypersensitive CRP levels during pregnancy and their relationship with gestational diabetes mellitus
- Synergistic immuno-modulatory activity in human macrophages of a medicinal mushroom formulation consisting of Reishi, Shiitake and Maitake
- Investigating reindeer pastoralism and exploitation of high mountain zones in northern Mongolia through ice patch archaeology
- Diversity pattern of Plasmodium knowlesi merozoite surface protein 4 (MSP4) in natural population of Malaysia
- Protein synthesis rates of muscle, tendon, ligament, cartilage, and bone tissue in vivo in humans
- “What gets measured better gets done better”: The landscape of validation of global maternal and newborn health indicators through key informant interviews
- Contactless monitoring of heart and respiratory rate in anesthetized pigs using infrared thermography
- Molecular characterisation of genital human papillomavirus among women in Southwestern, Nigeria
- The impact of “male clinics” on health-seeking behaviors of adult men in rural Kenya
- Gene expression microarray public dataset reanalysis in chronic obstructive pulmonary disease
- Utility of the new cobas HCV test for viral load monitoring during direct-acting antiviral therapy
- Impact of negative tuberculin skin test on growth among disadvantaged Bangladeshi children
- Streptococcal phosphotransferase system imports unsaturated hyaluronan disaccharide derived from host extracellular matrices
- Maternal diet modulates placental nutrient transporter gene expression in a mouse model of diabetic pregnancy
- Effects of an incremental theory of personality intervention on the reciprocity between bullying and cyberbullying victimization and perpetration in adolescents
- The clot thickens: Autologous and allogeneic fibrin sealants are mechanically equivalent in an ex vivo model of cartilage repair
- Reproducibility, stability, and accuracy of microbial profiles by fecal sample collection method in three distinct populations
- Cooperation with autonomous machines through culture and emotion
- Variation in hybridogenetic hybrid emergence between populations of water frogs from the Pelophylax esculentus complex
- Breast cancer in Tanzanian, black American, and white American women: An assessment of prognostic and predictive features, including tumor infiltrating lymphocytes
- Intramolecular tautomerization of the quercetin molecule due to the proton transfer: QM computational study
- A global overview of cassava genetic diversity
- Whole body periodic acceleration in normal and reduced mucociliary clearance of conscious sheep
- Identifying resurrection genes through the differentially expressed genes between Selaginella tamariscina (Beauv.) spring and Selaginella moellendorffii Hieron under drought stress
- Impact of hemodialysis on the concentrations of sodium and potassium during infusion of sodium thiosulfate using an In Vitro hemodialysis model
- Minimal effects of oyster aquaculture on local water quality: Examples from southern Chesapeake Bay
- Suboptimal infant and young child feeding practices in rural Boucle du Mouhoun, Burkina Faso: Findings from a cross-sectional population-based survey
- High salinity tolerance of invasive blue catfish suggests potential for further range expansion in the Chesapeake Bay region
- From waste to food: Optimising the breakdown of oil palm waste to provide substrate for insects farmed as animal feed
- Quantitative assessment of interstitial lung disease in Sjögren’s syndrome
- Comparative efficacy of tenofovir and entecavir in nucleos(t)ide analogue-naive chronic hepatitis B: A systematic review and meta-analysis
- Reference ranges for ultrasonographic renal dimensions as functions of age and body indices: A retrospective observational study in Taiwan
- Finding phrases: On the role of co-verbal facial information in learning word order in infancy
- Mathematical modeling reveals the factors involved in the phenomena of cancer stem cells stabilization
- Effects of forest management and roe deer impact on a mountain forest development in the Italian Apennines: A modelling approach using LANDIS-II
- Evaluation of comprehensive improvement for mild and moderate soil salinization in arid zone
- Efficacy, acceptability and feasibility of daily text-messaging in promoting glycaemic control and other clinical outcomes in a low-resource setting of South Africa: A randomised controlled trial
- Magnitude and associated factors of postpartum depression among women in Nekemte town, East Wollega zone, west Ethiopia, 2019: A community-based study
- Comparison of continuous wave and cold lateral condensation filling techniques in 3D printed simulated C-shape canals instrumented with Reciproc Blue or Hyflex EDM
- Effect of caffeine on neuromuscular function following eccentric-based exercise
- AtUBL5 regulates growth and development through pre-mRNA splicing in Arabidopsis thaliana
- The gut microbiome of freshwater Unionidae mussels is determined by host species and is selectively retained from filtered seston
- Alcohol consumption and survival after breast cancer diagnosis in Japanese women: A prospective patient cohort study
- Selection of reference genes for normalization of cranberry (Vaccinium macrocarpon Ait.) gene expression under different experimental conditions
- The household economic costs associated with depression symptoms: A cross-sectional household study conducted in the North West province of South Africa
- Increased cell size, structural complexity and migration of cancer cells acquiring fibroblast organelles by cell-projection pumping
- Acute low- compared to high-load resistance training to failure results in greater energy expenditure during exercise in healthy young men
- Impact of body mass index and metabolically unhealthy status on mortality in the Japanese general population: The JMS cohort study
- Characterization of two thermophilic cellulases from Talaromyces leycettanus JCM12802 and their synergistic action on cellulose hydrolysis
- Ecohydrology of urban trees under passive and active irrigation in a semiarid city
- Cyclosporine A eyedrops with self-nanoemulsifying drug delivery systems have improved physicochemical properties and efficacy against dry eye disease in a murine dry eye model
- LFastqC: A lossless non-reference-based FASTQ compressor
- Highly accurate prediction of flammability limits of chemical compounds using novel integrated hybrid models
- Nonsteroidal anti-inflammatory drugs and acetaminophen ameliorate muscular mechanical hyperalgesia developed after lengthening contractions via cyclooxygenase-2 independent mechanisms in rats
- A popular Indian clove-based mosquito repellent is less effective against Culex quinquefasciatus and Aedes aegypti than DEET
- Yeasts affect tolerance of Drosophila melanogaster to food substrate with high NaCl concentration
- The effect of climate change on cholera disease: The road ahead using artificial neural network
- Grit (effortful persistence) can be measured with a short scale, shows little variation across socio-demographic subgroups, and is associated with career success and career engagement
- Micro-dislodgement during transcatheter aortic valve implantation with a contemporary self-expandable prosthesis
- Improving the antimicrobial efficacy against resistant Staphylococcus aureus by a combined use of conjugated oligoelectrolytes
- Kin discrimination and outer membrane exchange in Myxococcus xanthus: Experimental analysis of a natural population
- Inflammatory cell infiltrates, hypoxia, vascularization, pentraxin 3 and osteoprotegerin in abdominal aortic aneurysms – A quantitative histological study
- Effects of virtual reality rehabilitation training on gait and balance in patients with Parkinson's disease: A systematic review
- Serum miR-33a is associated with steatosis and inflammation in patients with non-alcoholic fatty liver disease after liver transplantation
- Association between housing tenure and self-rated health in Japan: Findings from a nationwide cross-sectional survey
- Investigation of biochemical and physiological parameters of the newborn Saiga antelope (Saiga tatarica) in Gansu Province, China
- One-year follow-up of changes in refraction and aberrations induced by corneal incision
- Evaluation of upper limb superficial venous percussion as a sign of anatomical location and venous permeability. A comparative study of superficial venous percussion to ultrasound findings on non-renal patients and on chronic kidney disease patients
- An assessment of the Dutch experience with health insurers acting as healthcare advisors
- Perception of potential harm and benefits of HIV vaccine trial participation: A qualitative study from urban Tanzania
- Veterans with Gulf War Illness exhibit distinct respiratory patterns during maximal cardiopulmonary exercise
- Deep brain stimulation restores the glutamatergic and GABAergic synaptic transmission and plasticity to normal levels in kindled rats
- Metformin strongly affects transcriptome of peripheral blood cells in healthy individuals
- Cranberry extracts promote growth of Bacteroidaceae and decrease abundance of Enterobacteriaceae in a human gut simulator model
- Long-term retention on antiretroviral therapy among infants, children, adolescents and adults in Malawi: A cohort study
- Histochemical quantification of collagen content in articular cartilage
- Optogenetically transduced human ES cell-derived neural progenitors and their neuronal progenies: Phenotypic characterization and responses to optical stimulation
- Ion torrent high throughput mitochondrial genome sequencing (HTMGS)
- Outpatient antibiotic prescription rate and pattern in the private sector in India: Evidence from medical audit data
- Acute Influenza A virus outbreak in an enzootic infected sow herd: Impact on viral dynamics, genetic and antigenic variability and effect of maternally derived antibodies and vaccination
- Prevalence and correlates of low serum calcium in late pregnancy: A cross sectional study in the Nkongsamba Regional Hospital; Littoral Region of Cameroon
- Home-cage monitoring ascertains signatures of ictal and interictal behavior in mouse models of generalized seizures
- CRISPR/Cas9 gene editing in the West Nile Virus vector, Culex quinquefasciatus Say
- Genetic susceptibility to angiotensin-converting enzyme-inhibitor induced angioedema: A systematic review and evaluation of methodological approaches
- Proton pump inhibitor use increases the risk of peritonitis in peritoneal dialysis patients
- Comparative distribution of extended-spectrum beta-lactamase–producing Escherichia coli from urine infections and environmental waters
- Sex differences in thigh muscle volumes, sprint performance and mechanical properties in national-level sprinters
- Maternal serum and cord blood leptin concentrations at delivery
- Winter nitrification in ice-covered lakes
- Intolerance of uncertainty fuels depressive symptoms through rumination: Cross-sectional and longitudinal studies
- Monitoring exercise-induced muscle damage indicators and myoelectric activity during two weeks of knee extensor exercise training in young and old men
- Can adoption of pollution prevention techniques reduce pollution substitution?
- The association between self-efficacy and self-management behaviors among Chinese patients with type 2 diabetes
- Poly-arginine-18 peptides do not exacerbate bleeding, or improve functional outcomes following collagenase-induced intracerebral hemorrhage in the rat
- Affective disorders in the elderly in different European countries: Results from the MentDis_ICF65+ study
- Evaluation of forearm vascular resistance during orthostatic stress: Velocity is proportional to flow and size doesn’t matter
- Proton pencil minibeam irradiation of an in-vivo mouse ear model spares healthy tissue dependent on beam size
- Maternal stress in Shank3ex4-9 mice increases pup-directed care and alters brain white matter in male offspring
- Aspartate aminotransferase-to-platelet ratio index (APRI): A potential marker for diagnosis in patients at risk of severe malaria caused by Plasmodium vivax
- Exploiting open source 3D printer architecture for laboratory robotics to automate high-throughput time-lapse imaging for analytical microbiology
- Long non-coding RNAs and latent HIV – A search for novel targets for latency reversal
- Clinical characteristics of neonatal fulminant necrotizing enterocolitis in a tertiary Children's hospital in the last 10 years
- Effects of neuromuscular electrical stimulation training on muscle size in collegiate track and field athletes
- Adaptive fuzzy flow rate control considering multifractal traffic modeling and 5G communications
- Evaluation of four commercial tests for detecting ceftiofur in waste milk bulk tank samples
- A smart tele-cytology point-of-care platform for oral cancer screening
- Vasopressin SNP pain factors and stress in sickle cell disease
- Carbonate production of Micronesian reefs suppressed by thermal anomalies and Acanthaster as sea-level rises
- Microbial metabolisms in an abyssal ferromanganese crust from the Takuyo-Daigo Seamount as revealed by metagenomics
- Incidence of chronic kidney disease hospitalisations and mortality in Espírito Santo between 1996 to 2017
- The impact of short-term machine perfusion on the risk of cancer recurrence after rat liver transplantation with donors after circulatory death
- Proteomic profiling of the thrombin-activated canine platelet secretome (CAPS)
- Blood metal levels and serum testosterone concentrations in male and female children and adolescents: NHANES 2011–2012
- The effects of prolonged single night session of videogaming on sleep and declarative memory
- Diversity, distribution and dynamics of large trees across an old-growth lowland tropical rain forest landscape
- Mapping developmental QTL for plant height in soybean [Glycine max (L.) Merr.] using a four-way recombinant inbred line population
- Vaginal ring acceptability and related preferences among women in low- and middle-income countries: A systematic review and narrative synthesis
- UM171 induces a homeostatic inflammatory-detoxification response supporting human HSC self-renewal
- Positive selection and precipitation effects on the mitochondrial NADH dehydrogenase subunit 6 gene in brown hares (Lepus europaeus) under a phylogeographic perspective
- Evaluation of Minimum Inhibitory Concentrations for 154 Mycoplasma synoviae isolates from Italy collected during 2012-2017
- Enhancement of antibiotics antimicrobial activity due to the silver nanoparticles impact on the cell membrane
- Correction: Smoking, alcohol use disorder and tuberculosis treatment outcomes: A dual co-morbidity burden that cannot be ignored
- Correction: Effect of corruption on perceived difficulties in healthcare access in sub-Saharan Africa
- Knowledge-based best of breed approach for automated detection of clinical events based on German free text digital hospital discharge letters
- Importance of thorough tissue and cellular level characterization of targeted drugs in the evaluation of pharmacodynamic effects
- Integrated value-chain and risk assessment of Pig-Related Zoonoses in Ghana
- Failed sperm retrieval from severely oligospermic or non-obstructive azoospermic patients on oocyte retrieval day: Emergent oocyte cryopreservation is a feasible strategy
- Cassava yield traits predicted by genomic selection methods
- Verification of hub genes in the expression profile of aortic dissection
- Pig farmers’ willingness to pay for management strategies to reduce aggression between pigs
- Metabolomic response of Euglena gracilis and its bleached mutant strain to light
- Diagnostic value of ASVS for insulinoma localization: A systematic review and meta-analysis
- Newly educated care managers’ experiences of providing care for persons with stress-related mental disorders in the clinical primary care context
- Real-time telemetry monitoring of oxygen in the central complex of freely-walking Gromphadorhina portentosa
- Qualification programmes for immigrant health professionals: A systematic review
- An analytical model to minimize the latency in healthcare internet-of-things in fog computing environment
- Grain filling of early-season rice cultivars grown under mechanical transplanting
- Intercalation of small molecules into DNA in chromatin is primarily controlled by superhelical constraint
- Correlative evidence for co-regulation of phosphorus and carbon exchanges with symbiotic fungus in the arbuscular mycorrhizal Medicago truncatula
- How to design a dose-finding study on combined agents: Choice of design and development of R functions
- Altered expression of Notch1 in Alzheimer's disease
- The ZJU index is a powerful surrogate marker for NAFLD in severely obese North American women
- Trunk velocity-dependent Light Touch reduces postural sway during standing
- Evaluation of cytological diagnostic accuracy for canine splenic neoplasms: An investigation in 78 cases using STARD guidelines
- Trade-offs in motivating volunteer effort: Experimental evidence on voluntary contributions to science
- Does caching strategy vary with microclimate in endangered Mt. Graham red squirrels?
- Assessment of energy expenditure during high intensity cycling and running using a heart rate and activity monitor in young active adults
- Evaluating rectal swab collection method for gut microbiome analysis in the common marmoset (Callithrix jacchus)
- Implementation of a screening, brief intervention and referral to treatment programme for risky substance use in South African emergency centres: A mixed methods evaluation study
- Can the CalproQuest predict a positive Calprotectin test? A prospective diagnostic study
- The calcium sensor OsCBL1 modulates nitrate signaling to regulate seedling growth in rice
- Acceptability of and treatment preferences for recurrent bacterial vaginosis—Topical lactic acid gel or oral metronidazole antibiotic: Qualitative findings from the VITA trial
- Mathematical determination of the HIV-1 matrix shell structure and its impact on the biology of HIV-1
- Contingent negative variation during a modified cueing task in simulated driving
- CAMDI interacts with the human memory-associated protein KIBRA and regulates AMPAR cell surface expression and cognition
- Effect of feeding patterns on growth and nutritional status of children aged 0-24 months: A Chinese cohort study
- A fecal sequel: Testing the limits of a genetic assay for bat species identification
- Measuring the impact of chronic conditions and associated multimorbidity on health-related quality of life in the general population in Hong Kong SAR, China: A cross-sectional study
- Short and long-term clinical effectiveness and cost-effectiveness of a late-phase community-based balance and gait exercise program following hip fracture. The EVA-Hip Randomised Controlled Trial
- Vaccine cold chain in general practices: A prospective study in 75 refrigerators (Keep Cool study)
- Brazilian norms for the Bank of Standardized Stimuli (BOSS)
- Distinct varieties of aesthetic chills in response to multimedia
- Interaction between apolipoprotein E genotype and hypertension on cognitive function in older women in the Nurses’ Health Study
- Correction: Resistance profile of the HIV-1 maturation inhibitor GSK3532795 in vitro and in a clinical study
- New formulation of the Gompertz equation to describe the kinetics of untreated tumors
- Development of visual perception of others’ actions: Children’s judgment of lifted weight
- Retrospective comparative analysis of intraocular lens calculation formulas after hyperopic refractive surgery
- Human vitreous concentrations of citicoline following topical application of citicoline 2% ophthalmic solution
- Development and validation of exhaled breath condensate microRNAs to identify and endotype asthma in children
- Arthroscopic release for frozen shoulder: Does the timing of intervention and diabetes affect outcome?
- Risk factors affecting dairy cattle protective grouping behavior, commonly known as bunching, against Stomoxys calcitrans (L.) on California dairies
- Acceleration of chemical shift encoding-based water fat MRI for liver proton density fat fraction and T2* mapping using compressed sensing
- Characterisation and microbial community analysis of lipid utilising microorganisms for biogas formation
- Sexuality in male partners of women with fibromyalgia syndrome: A qualitative study
- Exploring optimization strategies for improving explicit water models: Rigid n-point model and polarizable model based on Drude oscillator
- Artificial insemination with fresh, liquid stored and frozen thawed semen in dromedary camels
- Moving into an urban drug scene among people who use drugs in Vancouver, Canada: Latent class growth analysis
- Numerical study on the start and unstart phenomena in a scramjet inlet-isolator model
- Effects of dietary supplementation with apple peel powder on the growth, blood and liver parameters, and transcriptome of genetically improved farmed tilapia (GIFT, Oreochromis niloticus)
- Urban growth simulation in different scenarios using the SLEUTH model: A case study of Hefei, East China
- Chronic bronchitis without airflow obstruction, asthma and rhinitis are differently associated with cardiovascular risk factors and diseases
- Factors associated with medication adherence among people with diabetes mellitus in poor urban areas of Cambodia: A cross-sectional study
- Mammary microbiome of lactating organic dairy cows varies by time, tissue site, and infection status
- Force field generalization and the internal representation of motor learning
- Polyphenism of visual and chemical secondary sexually-selected wing traits in the butterfly Bicyclus anynana: How different is the intermediate phenotype?
- Minimal genetic differentiation of the malaria vector Nyssorhynchus darlingi associated with forest cover level in Amazonian Brazil
- The impact of leisure activities on older adults’ cognitive function, physical function, and mental health
- scafSLICR: A MATLAB-based slicing algorithm to enable 3D-printing of tissue engineering scaffolds with heterogeneous porous microarchitecture
- Association of serum leptin and adiponectin concentrations with echocardiographic parameters and pathophysiological states in patients with cardiovascular disease receiving cardiovascular surgery
- Operation of cognitive memory inhibition in adults with Down syndrome: Effects of maintenance load and material
- Influences on surgical antimicrobial prophylaxis decision making by surgical craft groups, anaesthetists, pharmacists and nurses in public and private hospitals
- Post-treatment Lyme disease symptoms score: Developing a new tool for research
- Expression of Concern: The Role of the RACK1 Ortholog Cpc2p in Modulating Pheromone-Induced Cell Cycle Arrest in Fission Yeast
- Equine bronchial fibroblasts enhance proliferation and differentiation of primary equine bronchial epithelial cells co-cultured under air-liquid interface
- Investigating cooperation with robotic peers
- Synthesis, purification and crystallization of a putative critical bulge of HAR1 RNA
- Prosthetic push-off power in trans-tibial amputee level ground walking: A systematic review
- A case study of the use of verbal reports for talent identification purposes in soccer: A Messi affair!
- Transgenerational deep sequencing revealed hypermethylation of hippocampal mGluR1 gene with altered mRNA expression of mGluR5 and mGluR3 associated with behavioral changes in Sprague Dawley rats with history of prolonged febrile seizure
- Obesity is associated with an impaired survival in lymphoma patients undergoing autologous stem cell transplantation
- Periodontal disease: Repercussions in pregnant woman and newborn health—A cohort study
- Origins of Chinese reindeer (Rangifer tarandus) based on mitochondrial DNA analyses
- Regional, racial, gender, and tumor biology disparities in breast cancer survival rates in Africa: A systematic review and meta-analysis
- How effective are films in inducing positive and negative emotional states? A meta-analysis
- 3D nanostructural characterisation of grain boundaries in atom probe data utilising machine learning methods
- An outbreak of tuberculosis in a middle school in Henan, China: Epidemiology and risk factors
- Initial clinical radiological findings and staging to predict prognosis of primary hepatic angiosarcoma: A retrospective analysis
- A new early Eocene deperetellid tapiroid illuminates the origin of Deperetellidae and the pattern of premolar molarization in Perissodactyla
- Longevity and marginal bone loss of narrow-diameter implants supporting single crowns: A systematic review
- Impact of UVC-sustained recirculating air filtration on airborne bacteria and dust in a pig facility
- Cold-related Florida manatee mortality in relation to air and water temperatures
- Conceptual fluency in inductive reasoning
- Clinical outcomes and treatment patterns among Medicare patients with nonvalvular atrial fibrillation (NVAF) and chronic kidney disease
- Improvements in the learnability of smartphone haptic interfaces for visually impaired users
- Role of the malic enzyme in metabolism of the halotolerant methanotroph Methylotuvimicrobium alcaliphilum 20Z
- Cyclic loading test study on a new cast-in-situ insulated sandwich concrete wall
- Natural compounds as angiogenic enzyme thymidine phosphorylase inhibitors: In vitro biochemical inhibition, mechanistic, and in silico modeling studies
- Analysis of virulence potential of Escherichia coli O145 isolated from cattle feces and hide samples based on whole genome sequencing
- Pre-clinical medical student reflections on implicit bias: Implications for learning and teaching
- Prognostic significance of non-sustained ventricular tachycardia on stored electrograms in pacemaker recipients
- Determinants of preterm birth among mothers who gave birth at public hospitals in the Amhara region, Ethiopia: A case-control study
- Real-world evidence of the effectiveness of ombitasvir-paritaprevir/r ± dasabuvir ± ribavirin in patients monoinfected with chronic hepatitis C or coinfected with human immunodeficiency virus-1 in Spain
- Unique transcriptomic landscapes identified in idiopathic spontaneous and infection related preterm births compared to normal term births
- Restrained expansion of the recall germinal center response as biomarker of protection for influenza vaccination in mice
- Arabidopsis TRM5 encodes a nuclear-localised bifunctional tRNA guanine and inosine-N1-methyltransferase that is important for growth
- Achievement of weight loss in patients with overweight during dietetic treatment in primary health care
- Autophagy deficiency exacerbates colitis through excessive oxidative stress and MAPK signaling pathway activation
- The impacts of parity on lung function data (LFD) of healthy females aged 40 years and more issued from an upper middle income country (Algeria): A comparative study
- Reorganization of spatial configurations in visual working memory: A matter of set size?
- Unravelling travellers’ route choice behaviour at full-scale urban network by focusing on representative OD pairs in computer experiments
- Evaluating the higher-order structure of the Profile of Emotional Competence (PEC): Confirmatory factor analysis and Bayesian structural equation modeling
- HIV prevalence and correlated factors among male clients of female sex workers in a border region of China
- Next generation sequencing and RNA-seq characterization of adipose tissue in the Nile crocodile (Crocodylus niloticus) in South Africa: Possible mechanism(s) of pathogenesis and pathophysiology of pansteatitis
- Association between advanced maternal age and maternal and neonatal morbidity: A cross-sectional study on a Spanish population
- Ethnic differences in the prevalence, socioeconomic and health related risk factors of knee pain and osteoarthritis symptoms in older Malaysians
- Increasing knowledge of HIV status in a country with high HIV testing coverage: Results from the Botswana Combination Prevention Project
- Friends with benefits: The effects of vegetative shading on plant survival in a green roof environment
- Comparison of the fecal, cecal, and mucus microbiome in male and female mice after TNBS-induced colitis
- Identifying candidate diagnostic markers for early stage of non-small cell lung cancer
- Complex alternative splicing of human Endonuclease V mRNA, but evidence for only a single protein isoform
- Correction: KML001 Induces Apoptosis and Autophagic Cell Death in Prostate Cancer Cells via Oxidative Stress Pathway
- Unique developmental trajectories of risk behaviors in adolescence and associated outcomes in young adulthood
- Enhanced fibrinolysis detection in a natural occurring canine model with intracavitary effusions: Comparison and degree of agreement between thromboelastometry and FDPs, D-dimer and fibrinogen concentrations
- Overexpression of Saussurea involucrata dehydrin gene SiDHN promotes cold and drought tolerance in transgenic tomato plants
- Foxtail millet (Setaria italica (L.) P. Beauv) CIPKs are responsive to ABA and abiotic stresses
- Autonomous drone hunter operating by deep learning and all-onboard computations in GPS-denied environments
- Heterogeneity Diffusion Imaging of gliomas: Initial experience and validation
- Frequency cluster formation and slow oscillations in neural populations with plasticity
- DHP23002 as a next generation oral paclitaxel formulation for pancreatic cancer therapy
- Diagnostic accuracy of SOX11 immunohistochemistry in mantle cell lymphoma: A meta-analysis
- Analytical solution to swing equations in power grids
- Pathways to conspiracy: The social and linguistic precursors of involvement in Reddit’s conspiracy theory forum
- Spatiotemporally random and diverse grid cell spike patterns contribute to the transformation of grid cell to place cell in a neural network model
- Empathic concern and personal distress depend on situational but not dispositional factors
- Who is more susceptible to job stressors and resources? Sensory-processing sensitivity as a personal resource and vulnerability factor
- Cost-effectiveness of integrating postpartum antiretroviral therapy and infant care into maternal & child health services in South Africa
- A substitution mutation in a conserved domain of mammalian acetate-dependent acetyl CoA synthetase 2 results in destabilized protein and impaired HIF-2 signaling
- One step at a time: Physical activity is linked to positive interpretations of ambiguity
- Calreticulin regulates vascular endothelial growth factor-A mRNA stability in gastric cancer cells
- Evaluation of various methods of selection of B. subtilis strains capable of secreting surface-active compounds
- Association between US Pharmacopeia (USP) monograph standards, generic entry and prescription drug costs
- Molecular characterisation of the synovial fluid microbiome in rheumatoid arthritis patients and healthy control subjects
- On sorption hysteresis in wood: Separating hysteresis in cell wall water and capillary water in the full moisture range
- Inbreeding, Allee effects and stochasticity might be sufficient to account for Neanderthal extinction
- Reliability and construct validity of the stepping-forward affordance perception test for fall risk assessment in community-dwelling older adults
- Socioeconomic determinants of nutritional status among ‘Baiga’ tribal children In Balaghat district of Madhya Pradesh: A qualitative study
- Study on characteristics of fire plume in building facade window under lateral blow
- ‘When you talk to someone in a bad way or always put her under pressure, it is actually worse than beating her’: Conceptions and experiences of emotional intimate partner violence in Rwanda and South Africa
- Effects of 6-mercaptopurine in pressure overload induced right heart failure
- The association between haemoglobin levels in the first 20 weeks of pregnancy and pregnancy outcomes
- Implementation and evaluation of an antimicrobial stewardship programme in companion animal clinics: A stepped-wedge design intervention study
- Factors associated with persistently high-cost health care utilization for musculoskeletal pain
- Nitrogen and chlorophyll status determination in durum wheat as influenced by fertilization and soil management: Preliminary results
- Effect of repeated in vivo microCT imaging on the properties of the mouse tibia
- Coupling environment and physiology to predict effects of climate change on the taxonomic and functional diversity of fish assemblages in the Murray-Darling Basin, Australia
- Hematology and plasma biochemistries in the Blanding’s turtle (Emydoidea blandingii) in Lake County, Illinois
- CRISPR-Cas influences the acquisition of antibiotic resistance in Klebsiella pneumoniae
- Phosphorylation-dependent activity-based conformational changes in P21-activated kinase family members and screening of novel ATP competitive inhibitors
- Antidepressant prescriptions, discontinuation, depression and perinatal outcomes, including breastfeeding: A population cohort analysis
- Why men with a low-risk prostate cancer select and stay on active surveillance: A qualitative study
- Imported severe malaria and risk factors for intensive care: A single-centre retrospective analysis
- Combined treatment (image-guided thrombectomy and endovascular therapy with open femoral access) for acute lower limb ischemia: Clinical efficacy and outcomes
- Low-latency single channel real-time neural spike sorting system based on template matching
- Quantifying the scale effect in geospatial big data using semi-variograms
- Paper-and-pencil versus computerized administration mode: Comparison of data quality and risk behavior prevalence estimates in the European school Survey Project on Alcohol and other Drugs (ESPAD)
- Regression adjusted colocalisation colour mapping (RACC): A novel biological visual analysis method for qualitative colocalisation analysis of 3D fluorescence micrographs
- Ostrich eggshell bead diameter in the Holocene: Regional variation with the spread of herding in eastern and southern Africa
- Spatial and temporal variations in female size at maturity of a Southern Rock Lobster (Jasus edwardsii) population: A likely response to climate change
- Inactive USP14 and inactive UCHL5 cause accumulation of distinct ubiquitinated proteins in mammalian cells
- Training rhesus macaques to take daily oral antiretroviral therapy for preclinical evaluation of HIV prevention and treatment strategies
- Left ventricular structural and functional changes in Friedreich ataxia – Relationship with body size, sex, age and genetic severity
- Magnitude and factors associated with anemia among pregnant women attending antenatal care in Bench Maji, Keffa and Sheka zones of public hospitals, Southwest, Ethiopia, 2018: A cross -sectional study
- Effectiveness of telerehabilitation in the management of adults with stroke: A systematic review
- Hydrogen sulphide-induced hypometabolism in human-sized porcine kidneys
- Correction: Comparison of the molecular properties of retinitis pigmentosa P23H and N15S amino acid replacements in rhodopsin
- Retraction: Regulation of gastric smooth muscle contraction via Ca2+-dependent and Ca2+-independent actin polymerization
- Evaluation of neutral oral contrast agents for assessment of the small bowel at abdominal staging CT
- Blood type and breed-associated differences in cell marker expression on equine bone marrow-derived mesenchymal stem cells including major histocompatibility complex class II antigen expression
- Induced abortion and future use of IVF treatment; A nationwide register study
- Psychosocial determinants of sustained maternal functional impairment: Longitudinal findings from a pregnancy-birth cohort study in rural Pakistan
- Measurement of finger joint angle using stretchable carbon nanotube strain sensor
- Determinants of mortality among patients with drug-resistant tuberculosis in northern Nigeria
- Drugs modulating stochastic gene expression affect the erythroid differentiation process
- Efficacy of UB0316, a multi-strain probiotic formulation in patients with type 2 diabetes mellitus: A double blind, randomized, placebo controlled study
- Prognostic value of des-γ-carboxy prothrombin in patients with hepatocellular carcinoma treated with transarterial chemotherapy: A systematic review and meta-analysis
- Avermectin induces the oxidative stress, genotoxicity, and immunological responses in the Chinese Mitten Crab, Eriocheir sinensis
- Antibiotic use in mandarin production (Citrus reticulata Blanco) in major mandarin-producing areas in Thailand: A survey assessment
- Application of CPI cutoff value based on parentage testing of duos and trios typed by four autosomal kits
- Correction: Good and Bad in the Hands of Politicians: Spontaneous Gestures during Positive and Negative Speech
- Adolescents with worse levels of oral health literacy have more cavitated carious lesions
- Effective methods for the inactivation of Francisella tularensis
- Detection of early-stage Alzheimer’s pathology using blood-based autoantibody biomarkers in elderly hip fracture repair patients
- Correlation between internal pudendal artery stenosis and erectile dysfunction in patients with suspected coronary artery disease
- Analysis of HER2 genomic binding in breast cancer cells identifies a global role in direct gene regulation
- Population productivity of shovelnose rays: Inferring the potential for recovery
- Correction: Long-term clinical outcomes in a cohort of patients with solitary plasmacytoma treated in the modern era
- Effects of tetracycline on myocardial infarct size in obese rats with chemically-induced colitis
- Mineral absorption is an enriched pathway in a brain region of restless legs syndrome patients with reduced MEIS1 expression
- Changes in weight and body composition across five years at university: A prospective observational study
- Adeno-associated virus-mediated expression of human butyrylcholinesterase to treat organophosphate poisoning
- Effects of insulin signaling on mouse taste cell proliferation
- Patient-level cost of home- and facility-based child pneumonia treatment in Suba Sub County, Kenya
- TAP: A static analysis model for PHP vulnerabilities based on token and deep learning technology
- Cost-effectiveness of QuantiFERON-TB Gold In-Tube versus tuberculin skin test for diagnosis and treatment of Latent Tuberculosis Infection in primary health care workers in Brazil
- Multifaceted intervention for the prevention and management of musculoskeletal pain in nursing staff: Results of a cluster randomized controlled trial
- Changes over time in creatinine clearance and comparison of emergent adverse events for HIV-positive adults receiving standard doses (300 mg/day) of lamivudine-containing antiretroviral therapy with baseline creatinine clearance of 30–49 vs ≥50 mL/min
- Population dynamics of foxes during restricted-area culling in Britain: Advancing understanding through state-space modelling of culling records
- Impacts of experimental advisory exit speed sign on traffic speeds for freeway exit ramp
- In-hospital outcomes and 30-day readmission rates among ischemic and hemorrhagic stroke patients with delirium
- Monitoring quality indicators for the Xpert MTB/RIF molecular assay in Ethiopia
- Delivering genes across the blood-brain barrier: LY6A, a novel cellular receptor for AAV-PHP.B capsids
- Correction: Using remote sensing to detect whale strandings in remote areas: The case of sei whales mass mortality in Chilean Patagonia
- Comparison of the inoculum size effects of antibiotics on IMP-6 β-lactamase-producing Enterobacteriaceae co-harboring plasmid-mediated quinolone resistance genes
- Contrast-enhanced computed tomography findings of canine primary renal tumors including renal cell carcinoma, lymphoma, and hemangiosarcoma
- Non-invasive in vivo imaging of UCP1 expression in live mice via near-infrared fluorescent protein iRFP720
- Overexpression of pink1 or parkin in indirect flight muscles promotes mitochondrial proteostasis and extends lifespan in Drosophila melanogaster
- Fiber stiffness, pore size and adhesion control migratory phenotype of MDA-MB-231 cells in collagen gels
- Comparison of two experimental ARDS models in pigs using electrical impedance tomography
- Are primary school children attending full-day school still engaged in sports clubs?
- Stroke risks in women with dysmenorrhea by age and stroke subtype
- Changes in patterns of mortality rates and years of life lost due to firearms in the United States, 1999 to 2016: A joinpoint analysis
- In vitro modeling of Batrachochytrium dendrobatidis infection of the amphibian skin
- Development and validation of LC-MS/MS method for imatinib and norimatinib monitoring by finger-prick DBS in gastrointestinal stromal tumor patients
- Correction: Habitat disturbance and the organization of bacterial communities in Neotropical hematophagous arthropods
- Characterisation of early metazoan secretion through associated signal peptidase complex subunits, prohormone convertases and carboxypeptidases of the marine sponge (Amphimedon queenslandica)
- Time trends between 2002 and 2017 in correlates of self-reported sitting time in European adults
- Performance of patient acuity rating by rapid response team nurses for predicting short-term prognosis
- Changes in HbA1c during the first six years after the diagnosis of Type 2 diabetes mellitus predict long-term microvascular outcomes
- Correction: Antimicrobial resistance genotypes and phenotypes of Campylobacter jejuni isolated in Italy from humans, birds from wild and urban habitats, and poultry
- Correction: Mental health and quality of life outcomes in family members of patients with chronic critical illness admitted to the intensive care units of two Brazilian hospitals serving the extremes of the socioeconomic spectrum
- Correction: Establishing an infrastructure for collaboration in primate cognition research
- Correction: The impact of public health insurance on health care utilisation, financial protection and health status in low- and middle-income countries: A systematic review
- Health provider and service-user experiences of sensory modulation rooms in an acute inpatient psychiatry setting
- Comparison of potential drug-drug interactions with metabolic syndrome medications detected by two databases
- The Polish version of the Cultural Intelligence Scale: Assessment of its reliability and validity among healthcare professionals and medical faculty students
- Selection of optimal reference genes for qRT-PCR analysis of shoot development and graviresponse in prostrate and erect chrysanthemums
- Metastasis risk prediction model in osteosarcoma using metabolic imaging phenotypes: A multivariable radiomics model
- Defining hospital community benefit activities using Delphi technique: A comparison between China and the United States
- Establishment of the experimental procedure for prediction of conjugation capacity in mutant UGT1A1
- A robust multi-objective optimization framework to capture both cellular and intercellular properties in cardiac cellular model tuning: Analyzing different regions of membrane resistance profile in parameter fitting
- Sea star wasting disease demography and etiology in the brooding sea star Leptasterias spp.
- Diagnostic plasma miRNA-profiles for ovarian cancer in patients with pelvic mass
- Genetic diversity and drug resistance of HIV-1 among infected pregnant women newly diagnosed in Luanda, Angola
- I’ve been robbed! – Can changes in floral traits discourage bee pollination?
- Visualising statistical models using dynamic nomograms
- Assessing the capacity of Malawi’s district and central hospitals to manage traumatic diaphyseal femoral fractures in adults
- Diagnostic performance of basal cortisol level at 0900-1300h in adrenal insufficiency
- The Mastery Rubric for Bioinformatics: A tool to support design and evaluation of career-spanning education and training
- Microdissection and whole chromosome painting confirm karyotype transformation in cryptic species of the Lariophagus distinguendus (Förster, 1841) complex (Hymenoptera: Pteromalidae)
- Quality of Kangaroo Mother Care services in Ethiopia: Implications for policy and practice
- Gemcitabine potentiates the anti-tumour effect of radiation on medullary thyroid cancer
- iTRAQ-based high-throughput proteomics analysis reveals alterations of plasma proteins in patients infected with human bocavirus
- The detection of a non-anemophilous plant species using airborne eDNA
- Perception and control of low cable operation forces in voluntary closing body-powered upper-limb prostheses
- Neoadjuvant chemotherapy plus surgery versus concurrent chemoradiotherapy in stage IB2-IIB cervical cancer: A systematic review and meta-analysis
- Randomized methods to characterize large-scale vortical flow networks
- Disentangling the coexistence strategies of mud-daubing wasp species through trophic analysis in oases of Baja California peninsula
- Front-of-pack nutritional labels: Understanding by low- and middle-income Mexican consumers
- Distress in patients with end-stage renal disease: Staff perceptions of barriers to the identification of mild-moderate distress and the provision of emotional support
- Pathways to antibiotics in Bangladesh: A qualitative study investigating how and when households access medicine including antibiotics for humans or animals when they are ill
- DOC export is exceeded by C fixation in May Creek: A late-successional watershed of the Copper River Basin, Alaska
- Behavioral observation of prosocial behavior and social initiative is related to preschoolers’ psychopathological symptoms
- Evaluating the impact of citations of articles based on knowledge flow patterns hidden in the citations
- Correction: Economic sanctions and academia: Overlooked impact and long-term consequences
- Correction: A novel association between relaxin receptor polymorphism and hematopoietic stem cell yield after mobilization
- Expression of Concern: Cooperativity of Oncogenic K-Ras and Downregulated p16/INK4A in Human Pancreatic Tumorigenesis
- Price dispersion of generic medications
- Sex differences in body composition but not neuromuscular function following long-term, doxycycline-induced reduction in circulating levels of myostatin in mice
- The emotion regulation effect of cognitive control is related to depressive state through the mediation of rumination: An ERP study
- Comparison of SMS-EPI and 3D-EPI at 7T in an fMRI localizer study with matched spatiotemporal resolution and homogenized excitation profiles
- Left ventricular mass normalization for body size in children based on an allometrically adjusted ratio is as accurate as normalization based on the centile curves method
- Correction: Combining biophysical parameters, spectral indices and multivariate hyperspectral models for estimating yield and water productivity of spring wheat across different agronomic practices
- Correction: Flowers as viral hot spots: Honey bees (Apis mellifera) unevenly deposit viruses across plant species
- 'Small small quarrels bring about happiness or love in the relationships’: Exploring community perceptions and gendered norms contributing to male perpetrated intimate partner violence in the Central Region of Ghana
- The performance of practitioners conducting facial comparisons on images of children across age
- Increased amounts and stability of telomeric repeat-containing RNA (TERRA) following DNA damage induced by etoposide
- Patients with limitation or withdrawal of life supporting care admitted in a medico-surgical intermediate care unit: Prevalence, description and outcome over a six-month period
- Correction: Diverse radiofrequency sensitivity and radiofrequency effects of mobile or cordless phone near fields exposure in Drosophila melanogaster
- Predicting the performance of TV series through textual and network analysis: The case of Big Bang Theory
- Risk of temperature, humidity and concentrations of air pollutants on the hospitalization of AECOPD
- Mixed methods grant applications in the health sciences: An analysis of reviewer comments
- Renal abnormalities among children with sickle cell conditions in highly resource-limited setting in Ghana
- Size matters: How reaching and vergence movements are influenced by the familiar size of stereoscopically presented objects
- Willingness to receive institutional and community-based eldercare among the rural elderly in China
- An improved deep learning method for predicting DNA-binding proteins based on contextual features in amino acid sequences
- Beyond executive functions, creativity skills benefit academic outcomes: Insights from Montessori education
- A LAMP assay for the rapid and robust assessment of Wolbachia infection in Aedes aegypti under field and laboratory conditions
- Nonarteritic anterior ischemic optic neuropathy is associated with cerebral small vessel disease
- Fiber-tract localized diffusion coefficients highlight patterns of white matter disruption induced by proximity to glioma
- The fight against polio through the NO-DO newsreels during the Francoism period in Spain
- Ocean sound levels in the northeast Pacific recorded from an autonomous underwater glider
- Cost-consequence analysis of influenza vaccination among the staff of a large teaching hospital in Rome, Italy: A pilot study
- The relationship among the progression of inflammation in umbilical cord, fetal inflammatory response, early-onset neonatal sepsis, and chorioamnionitis
- How medical professional students view older people with dementia: Implications for education and practice
- An enhanced nonparametric EWMA sign control chart using sequential mechanism
- Land use change, carbon stocks and tree species diversity in green spaces of a secondary city in Myanmar, Pyin Oo Lwin
- Is there a difference in women’s experiences of care with medication vs. manual vacuum aspiration abortions? Determinants of person-centered care for abortion services
- Maternal complications in pregnancy and childbirth for women with epilepsy: Time trends in a nationwide cohort
- Adsorption of oxytetracycline on kaolinite
- Interdisciplinary stratified care for low back pain: A qualitative study on the acceptability, potential facilitators and barriers to implementation
- The role of resource transfer in positive, non-additive litter decomposition
- The impact of language on the interpretation of resuscitation clinical care plans by doctors. A mixed methods study
- Quantum dots reveal heterogeneous membrane diffusivity and dynamic surface density polarization of dopamine transporter
- Genomic analysis of Shiga toxin-producing Escherichia coli from patients and asymptomatic food handlers in Japan
- The heavy metals lead and cadmium are cytotoxic to human bone osteoblasts via induction of redox stress
- Anatomical, taxonomic, and phylogenetic reappraisal of a poorly known ghost knifefish, Tembeassu marauna (Ostariophysi: Gymnotiformes), using X-ray microcomputed tomography
- Matrix-assisted laser desorption/ionization time of flight mass spectrometry identification of Vibrio (Listonella) anguillarum isolated from sea bass and sea bream
- Recommendations of older adults on how to use the PROM ‘TOPICS-MDS’ in healthcare conversations: A Delphi study
- The winner takes it all—Competitiveness of single nodes in globalized supply networks
- Hamsters in the city: A study on the behaviour of a population of common hamsters (Cricetus cricetus) in urban environment
- Correction: Liquid biopsies for omics-based analysis in sentinel mussels
- Size matters! Association between journal size and longitudinal variability of the Journal Impact Factor
- Drug resistance and epidemiology characteristics of multidrug-resistant tuberculosis patients in 17 provinces of China
- A model-based framework for chronic hepatitis C prevalence estimation
- Adding rewards to regulation: The impacts of watershed conservation on land cover and household wellbeing in Moyobamba, Peru
- Clinical determinants of social media use in individuals with schizophrenia
- Arsenic and nutrient absorption characteristics and antioxidant response in different leaves of two ryegrass (Lolium perenne) species under arsenic stress
- An evolution of socioeconomic related inequality in teenage pregnancy and childbearing in Malawi
- A single plasmid based CRISPR interference in Synechocystis 6803 – A proof of concept
- Structural vulnerability to narcotics-driven firearm violence: An ethnographic and epidemiological study of Philadelphia’s Puerto Rican inner-city
- Temporal trends in intracerebral hemorrhage: Evidence from the Austrian Stroke Unit Registry
- Prevalence and risk factors for multi-drug resistant Escherichia coli among poultry workers in the Federal Capital Territory, Abuja, Nigeria
- Prediction of disease-related metabolites using bi-random walks
- Clinical use, efficacy, and durability of maraviroc for antiretroviral therapy in routine care: A European survey
- Biomarker discovery in inflammatory bowel diseases using network-based feature selection
- The Cinderella Complex: Word embeddings reveal gender stereotypes in movies and books
- Exoproteome profiling of Trypanosoma cruzi during amastigogenesis early stages
- Reproducible phenotype alteration due to prolonged cooling of the pupae of Polyommatus icarus butterflies
- Nutritional treatment with an immune-modulating enteral formula alleviates 5-fluorouracil-induced adverse effects in rats
- Pharmacy-based predictors of non-adherence, non-persistence and reinitiation of antihypertensive drugs among patients on oral diabetes drugs in the Netherlands
- Systematic review of the accuracy of plasma preparation tubes for HIV viral load testing
- Circadian clock regulates the shape and content of dendritic spines in mouse barrel cortex
- “Anybody can make kids; it takes a real man to look after your kids”: Aboriginal men’s discourse on parenting
- Correction: A 1D computer model of the arterial circulation in horses: An important resource for studying global interactions between heart and vessels under normal and pathological conditions
- Maternal interpregnancy weight change and premature birth: Findings from an English population-based cohort study
- Correction: Identifying performance benchmarks and determinants for reproductive performance and calf survival using a longitudinal field study of cow-calf herds in western Canada
- Prognostic value of the model for end-stage liver disease excluding INR score (MELD-XI) in patients with adult congenital heart disease
- Treatment of Urethral Pain Syndrome (UPS) in Sweden
- Migration and political polarization in the U.S.: An analysis of the county-level migration network
- Epidemiology and complications of late-onset sepsis: an Italian area-based study
- The relationship between women’s experience of intimate partner violence and other socio-demographic factors, and under-5 children’s health in South Africa
- Association between trunk and gluteus muscle size and long jump performance
- Multimorbidity and complex multimorbidity in Brazilian rural workers
- Correction: Interspecific Phylogenic Relationships within Genus Melilotus Based on Nuclear and Chloroplast DNA
- Insulin-like growth factor (IGF)-II- mediated fibrosis in pathogenic lung conditions
- Wolf diet and prey selection in the South-Eastern Carpathian Mountains, Romania
- In vitro activity of aryl-thiazole derivatives against Schistosoma mansoni schistosomula and adult worms
- Sample size issues in multilevel logistic regression models
- Seed germination ecology of Ageratum houstonianum: A major invasive weed in Nepal
- Experiences of lifestyle change among women with gestational diabetes mellitus (GDM): A behavioural diagnosis using the COM-B model in a low-income setting
- Pharmacologic management of HCV treatment in patients with HCV monoinfection vs. HIV/HCV coinfection: Does coinfection really matter?
- The association between cigarette smoking and serum thyroid stimulating hormone, thyroid peroxidase antibodies and thyroglobulin antibodies levels in Chinese residents: A cross-sectional study in 10 cities
- Mouse movement measures enhance the stop-signal task in adult ADHD assessment
- Ecosystem functioning in urban grasslands: The role of biodiversity, plant invasions and urbanization
- Correction: KETOS: Clinical decision support and machine learning as a service – A training and deployment platform based on Docker, OMOP-CDM, and FHIR Web Services
- Does craniofacial morphology affect third molars impaction? Results from a population-based study in northeastern Germany
- Hyperconnectivity during screen-based stories listening is associated with lower narrative comprehension in preschool children exposed to screens vs dialogic reading: An EEG study
- Weight loss is associated with improved quality of life among rural women completers of a web-based lifestyle intervention
- Long-term high-grain diet altered the ruminal pH, fermentation, and composition and functions of the rumen bacterial community, leading to enhanced lactic acid production in Japanese Black beef cattle during fattening
- Beyond detoxification: Pleiotropic functions of multiple glutathione S-transferase isoforms protect mice against a toxic electrophile
- Golgi reassembly and stacking protein 65 downregulation is required for the anti-cancer effect of dihydromyricetin on human ovarian cancer cells
- SSR marker development in Clerodendrum trichotomum using transcriptome sequencing
- Risk factors for the carriage of Streptococcus infantarius subspecies infantarius isolated from African fermented dairy products
- Development of an intervention tool for precision oral self-care: Personalized and evidence-based practice for patients with periodontal disease
- Personal values in adolescence and psychological distress in adults: A cross-sectional study based on a retrospective recall
- Overactive bladder and bladder pain syndrome/interstitial cystitis in primary Sjögren’s syndrome patients: A nationwide population-based study
- Clinical utility of combined preimplantation genetic testing methods in couples at risk of passing on beta thalassemia/hemoglobin E disease: A retrospective review from a single center
- Hip stress distribution - Predictor of dislocation in hip arthroplasties. A retrospective study of 149 arthroplasties
- Mortality, morbidity, and cardiac surgery in Injection Drug Use (IDU)-associated versus non-IDU infective endocarditis: The need to expand substance use disorder treatment and harm reduction services
- Pup mortality in New Zealand sea lions (Phocarctos hookeri) at Enderby Island, Auckland Islands, 2013-18
- In vitro endothelial cell migration from limbal edge-modified Quarter-DMEK grafts
- Liquid Chromatography/Mass Spectrometry based serum metabolomics study on recurrent abortion women with antiphospholipid syndrome
- Gut carriage of antimicrobial resistance genes among young children in urban Maputo, Mozambique: Associations with enteric pathogen carriage and environmental risk factors
- Prepubertal nutrition alters Leydig cell functional capacity and timing of puberty
- Reliability of the Swedish version of the Evidence-Based Practice Attitude Scale assessing physiotherapist’s attitudes to implementation of evidence-based practice
- Mitochondrial alarmins are tissue mediators of ventilator-induced lung injury and ARDS
- Complete Chloroplast Genomes of Vachellia nilotica and Senegalia senegal: Comparative Genomics and Phylogenomic Placement in a New Generic System
- Retraction: Over-Expression of Superoxide Dismutase Ameliorates Cr(VI) Induced Adverse Effects via Modulating Cellular Immune System of Drosophila melanogaster
- Effect of pre-season training phase on anthropometric, hormonal and fitness parameters in young soccer players
- Exosomes from conditioned media of bone marrow-derived mesenchymal stem cells promote bone regeneration by enhancing angiogenesis
- Outcome of patients with heart failure after transcatheter aortic valve implantation
- Fatty acid profile of Romanian’s common bean (Phaseolus vulgaris L.) lipid fractions and their complexation ability by β-cyclodextrin
- Appropriate empirical antibiotic therapy and mortality: Conflicting data explained by residual confounding
- Treatment of corneal endothelial damage in a rabbit model with a bioengineered graft using human decellularized corneal lamina and cultured human corneal endothelium
- Telbivudine on IgG-associated hypergammaglobulinemia and TGF-β1 hyperactivity in hepatitis B virus-related liver cirrhosis
- Correction: Axial variation of deoxyhemoglobin density as a source of the low-frequency time lag structure in blood oxygenation level-dependent signals
- Correction: Mobile health-based physical activity intervention for individuals with spinal cord injury in the community: A pilot study
- Retraction: Placental expression of CD100, CD72 and CD45 is dysregulated in human miscarriage
- Correction: Use of IoT sensing and occupant surveys for determining the resilience of buildings to forest fire generated PM2.5
- Correction: The modulation of facial mimicry by attachment tendencies and their underlying affiliation motives in 3-year-olds: An EMG study
- Correction: Cognitive impairment in multiple sclerosis: An exploratory analysis of environmental and lifestyle risk factors
- Discovering novel disease comorbidities using electronic medical records
- Glutathione contributes to efficient post-Golgi trafficking of incoming HPV16 genome
- Epidemiology and antimicrobial resistance of methicillin-resistant Staphylococcus aureus isolates colonizing pigs with different exposure to antibiotics
- Social information use in adolescents: The impact of adults, peers and household composition
- Public practices on antibiotic use: A cross-sectional study among Qatar University students and their family members
- Effects of Topper Training on psychosocial problems, self-esteem, and peer victimisation in Dutch children: A randomised trial
- Comparative studies of two generations of NanoString nCounter System
- General practitioners’ perceptions of delayed antibiotic prescription for respiratory tract infections: A phenomenographic study
- Can altered magnetic field affect the foraging behaviour of ants?
- Parasitic infections and medical expenses according to Health Insurance Review Assessment claims data in South Korea, 2011–2018
- A prospective observational study of on-treatment plasma homocysteine levels as a biomarker of toxicity, depression and vitamin supplementation lead-in time pre pemetrexed, in patients with non-small cell lung cancer and malignant mesothelioma
- A strategy to identify protein-N-myristoylation-dependent phosphorylation reactions of cellular proteins by using Phos-tag SDS-PAGE
- Expression profile of sonic hedgehog signaling-related molecules in basal cell carcinoma
- Seasonal alternation of the ontogenetic development of the moon jellyfish Aurelia coerulea in Maizuru Bay, Japan
- Reliability of measurement of active trunk movement in wheelchair basketball players
- Chinese SLE Treatment and Research group (CSTAR) registry: Clinical significance of thrombocytopenia in Chinese patients with systemic lupus erythematosus
- Does source credibility matter for point-of-decision prompts? A quasi-experimental field study to increase stair use
- Male-pattern baldness and incident coronary heart disease and risk factors in the Heinz Nixdorf Recall Study
- Quality and utilization patterns of maternity waiting homes at referral facilities in rural Zambia: A mixed-methods multiple case analysis of intervention and standard of care sites
- Determining an optimal pool size for testing beef herds for Johne’s disease in Australia
- Correction: Change in larval fish assemblage in a USA east coast estuary estimated from twenty-six years of fixed weekly sampling
- APOE-knockout in rabbits causes loss of cells in nucleus pulposus and enhances the levels of inflammatory catabolic cytokines damaging the intervertebral disc matrix
- Testing Species Assignments in Extant Terebratulide Brachiopods: A Three-dimensional Geometric Morphometric Analysis of Long-Looped Brachidia
- A daily diary study on maladaptive daydreaming, mind wandering, and sleep disturbances: Examining within-person and between-persons relations
- Improved chemotherapy modeling with RAG-based immune deficient mice
- Effect of tracheal antimicrobial peptide on the development of Mannheimia haemolytica pneumonia in cattle
- The internal realities of individuals with type 2 diabetes – a functional framework of self-management practices via Grounded Theory approach
- Role of platelet parameters in early detection and prediction of severity of preeclampsia: A comparative cross-sectional study at Ayder comprehensive specialized and Mekelle general hospitals, Mekelle, Tigray, Ethiopia
- eIF4E and 4EBP1 are prognostic markers of head and neck squamous cell carcinoma recurrence after definitive surgery and adjuvant radiotherapy
- Smoking and other determinants of bone turnover
- Oxygen delivery, oxygen consumption and decreased kidney function after cardiopulmonary bypass
- School engagement of children in early grades: Psychometric, and gender comparisons
- Correction: A review of the elusive bicolored iris Snouted Treefrogs (Anura: Hylidae:Scinax uruguayus group)
- Perceived attractiveness of Czech faces across 10 cultures: Associations with sexual shape dimorphism, averageness, fluctuating asymmetry, and eye color
- Discovery of stable and prognostic CT-based radiomic features independent of contrast administration and dimensionality in oesophageal cancer
- Correction: Population-based dementia prediction model using Korean public health examination data: A cohort study
- Location, location, location: Close ties among older continuing care retirement community residents
- Correction: ISED: Constructing a high-resolution elevation road dataset from massive, low-quality in-situ observations derived from geosocial fitness tracking data
- Correction: Use of validated objective methods of locomotion characteristics and weight distribution for evaluating the efficacy of ketoprofen for alleviating pain in cows with limb pathologies
- Monitoring fine root growth to identify optimal fertilization timing in a forest plantation: A case study in Northeast Vietnam
- Metabolic costs of spontaneous swimming in Sprattus sprattus L., at different water temperatures
- Enterovirus 71 vaccine acceptance among parents of children < 5 years old and their knowledge of hand, foot and mouth disease, Chongqing, China, 2017
- Correction: Transcriptome profiling of mouse brain and lung under Dip2a regulation using RNA-sequencing
- Genetic diversity and antiretroviral resistance-associated mutation profile of treated and naive HIV-1 infected patients from the Northwest and Southwest regions of Cameroon
- Maximum parsimony interpretation of chromatin capture experiments
- Multiple innate antibacterial immune defense elements are correlated in diverse ungulate species
- Incidence and characteristics of ventricular tachycardia in patients after percutaneous coronary revascularization of chronic total occlusions
- Estimating measures of latent variables from m-alternative forced choice responses
- Clade F AAVHSCs cross the blood brain barrier and transduce the central nervous system in addition to peripheral tissues following intravenous administration in nonhuman primates
- First evidence of hepatitis E virus infection in a small mammal (yellow-necked mouse) from Croatia
- The inhibitory effects of polypyrrole on the biofilm formation of Streptococcus mutans
- Self-reported adverse drug effects and associated factors among H. pylori infected patients on standard triple therapy: Prospective follow up study
- Upregulation of ERK phosphorylation in rat dorsal root ganglion neurons contributes to oxaliplatin-induced chronic neuropathic pain
- Characterization of the relationship between neutron production and thermal load on a target material in an accelerator-based boron neutron capture therapy system employing a solid-state Li target
- Remote heart rate monitoring - Assessment of the Facereader rPPg by Noldus
- Seroprevalence of rubella virus antibodies among pregnant women in the Center and South-West regions of Cameroon
- Effectiveness of steam sterilization of reusable medical devices in primary and secondary care public hospitals in Nepal and factors associated with ineffective sterilization: A nation-wide cross-sectional study
- Relevance of HTLV-1 proviral load in asymptomatic and symptomatic patients living in endemic and non-endemic areas of Argentina
- Ritualized aggressive behavior reveals distinct social structures in native and introduced range tawny crazy ants
- The value of kinetic glomerular filtration rate estimation on medication dosing in acute kidney injury
- Screening and characterization of long noncoding RNAs involved in the albinism of Ananas comosus var. bracteatus leaves
- Visual attention to emotional faces in adolescents with social anxiety disorder receiving cognitive behavioral therapy
- A Q fever outbreak associated to courier transport of pets
- Antibodies against measles and rubella virus among different age groups in Thailand: A population-based serological survey
- Molecular diet analysis of Anguilliformes leptocephalus larvae collected in the western North Pacific
- Correction: The relationship between context, structure, and processes with outcomes of 6 regional diabetes networks in Europe
- Correction: The C-reactive protein/albumin ratio as an independent predictor of mortality in patients with severe sepsis or septic shock treated with early goal-directed therapy
- Interleukin 21 (IL-21) regulates chronic allograft vasculopathy (CAV) in murine heart allograft rejection
- Semantic computational analysis of anticoagulation use in atrial fibrillation from real world data
- The implementation of HTA in medicine pricing and reimbursement policies in Indonesia: Insights from multiple stakeholders
- International experiences during United States ophthalmology residency training: Current structure of international experiences and perspectives of faculty mentors at United States training institutions
- Questionable utility of digoxin in left-ventricular assist device recipients: A multicenter, retrospective analysis
- Genotyping and outcomes of presumptive second line ART failure cases switched to third line or maintained on second line ART in Mumbai, India
- A mathematical model of honey bee colony dynamics to predict the effect of pollen on colony failure
- Airway microbiome composition correlates with lung function and arterial stiffness in an age-dependent manner
- An odorant receptor from Anopheles gambiae that demonstrates enantioselectivity to the plant volatile, linalool
- Factors associated with full immunization of children 12–23 months of age in Ethiopia: A multilevel analysis using 2016 Ethiopia Demographic and Health Survey
- Additional evidence that the rat renal interstitium contracts in vivo
- Factors affecting acceptance of at-birth point of care HIV testing among providers and parents in Kenya: A qualitative study
- Removal efficiency of central vacuum system and protective masks to suspended particles from dental treatment
- Psychological well-being and distress in patients with generalized anxiety disorder: The roles of positive and negative functioning
- Conventional rotator cuff versus all-suture anchors—A biomechanical study focusing on the insertion angle in an unlimited cyclic model
- Are viral-infections associated with Ménière’s Disease? A systematic review and meta-analysis of molecular-markers of viral-infection in case-controlled observational studies of MD
- An evaluation of genetic causes and environmental risks for bilateral optic atrophy
- Comparative vector competence of the Afrotropical soft tick Ornithodoros moubata and Palearctic species, O. erraticus and O. verrucosus, for African swine fever virus strains circulating in Eurasia
- Effects of the solubility of yeast cell wall preparations on their potential prebiotic properties in dogs
- Carbogen gas-challenge BOLD fMRI in assessment of liver hypoxia after portal microcapsules implantation
- Socioeconomic determinants of cancer screening utilisation in Latin America: A systematic review
- Development of an easy-to-use questionnaire assessing critical care nursing competence in Japan: A cross-sectional study
- Towards successful business process improvement – An extension of change acceleration process model
- Correction: Dietary polyphenols as a safe and novel intervention for modulating pain associated with intervertebral disc degeneration in an in-vivo rat model
- Correction: Phylogenetic analysis of hepatitis C virus among HIV/ HCV co-infected patients in Nigeria
- Correction: Relationship between self-disclosure to first acquaintances and subjective well-being in people with schizophrenia spectrum disorders living in the community
- Impact of ATM rs1801516 on late skin reactions of radiotherapy for breast cancer: Evidences from a cohort study and a trial sequential meta-analysis
- Involvement of human and canine MRP1 and MRP4 in benzylpenicillin transport
- Soil organic matter rather than ectomycorrhizal diversity is related to urban tree health
- Clinical risk assessment in early pregnancy for preeclampsia in nulliparous women: A population based cohort study
- The relation between circulating levels of vitamin D and parathyroid hormone in children and adolescents with overweight or obesity: Quest for a threshold
- Behavioural evidence for segments as subordinate units in Chinese spoken word production: The form-preparation paradigm revisited
- Correction: Measuring the impact of an interdisciplinary learning project on nursing, architecture and landscape design students’ empathy
- Analysis of the characteristics of chemotherapy-resistant renal cell carcinomas based on global transcriptional analysis of their tissues and cell lines
- The characteristics and treatment patterns of patients with Parkinson’s disease in the United States and United Kingdom: A retrospective cohort study
- Sex differences in youth elite swimming
- Unconventional SCCmec types and low prevalence of the Panton-Valentine Leukocidin exotoxin in South African blood culture Staphylococcus aureus surveillance isolates, 2013-2016
- Prosocial perceptions of taxation predict support for taxes
- Correction: Clonality analysis of pulmonary tumors by genome-wide copy number profiling
- Improved oxygenation following methylprednisolone therapy and survival in paediatric acute respiratory distress syndrome
- Normative values for relative schoolbag weight in primary school children aged 6-14 from Czech Republic: A pilot study
- Correction: Intensive longitudinal modelling predicts diurnal activity of salivary alpha-amylase
- Correction: SNV discovery and functional candidate gene identification for milk composition based on whole genome resequencing of Holstein bulls with extremely high and low breeding values
- Monoclonal antibody anti-PBP2a protects mice against MRSA (methicillin-resistant Staphylococcus aureus) infections
- Diurnal variations of amplitude of accommodation in different age groups
- HHIP overexpression inhibits the proliferation, migration and invasion of non-small cell lung cancer
- Infusion of HIV-1 Nef-expressing astrocytes into the rat hippocampus induces enteropathy and interstitial pneumonitis and increases blood–brain-barrier permeability
- Correlation analysis of cold-related gene expression with physiological and biochemical indicators under cold stress in oil palm
- Student engagement and wellbeing over time at a higher education institution
- Gender-based differences in platelet function and platelet reactivity to P2Y12 inhibitors
- Influence of season and social context on male giant panda (Ailuropoda melanoleuca) vocal behaviour
- Development of an intravaginal ring for the topical delivery of Aurora kinase A inhibitor, MLN8237
- Differential phosphorylation determines the repressor and activator potencies of GLI1 proteins and their efficiency in modulating the HPV life cycle
- Polymorphisms of FDPS, LRP5, SOST and VKORC1 genes and their relation with osteoporosis in postmenopausal Romanian women
- Depression increases the risk of rotator cuff tear and rotator cuff repair surgery: A nationwide population-based study
- Interleukin-38 interacts with destrin/actin-depolymerizing factor in human keratinocytes
- Correction: Fast, quantitative, murine cardiac 19F MRI/MRS of PFCE-labeled progenitor stem cells and macrophages at 9.4T
- Persistent post-discharge opioid prescribing after traumatic brain injury requiring intensive care unit admission: A cross-sectional study with longitudinal outcome
- Genome-wide histone modification profiling of inner cell mass and trophectoderm of bovine blastocysts by RAT-ChIP
- Aerobic exercise increases post-exercise exogenous protein oxidation in healthy young males
- Selection for tandem stop codons in ciliate species with reassigned stop codons
- Research ethics in inter- and multi-disciplinary teams: Differences in disciplinary interpretations
- Correction: Analyzing data from the digital healthcare exchange platform for surveillance of antibiotic prescriptions in primary care in urban Kenya: A mixed-methods study
- Correction: People making deontological judgments in the Trapdoor dilemma are perceived to be more prosocial in economic games than they actually are
- LFRET, a novel rapid assay for anti-tissue transglutaminase antibody detection
- Effects of isotemporal substitution of sedentary behavior with light-intensity or moderate-to-vigorous physical activity on cardiometabolic markers in male adolescents
- Topical estrogen application to wounds promotes delayed cutaneous wound healing in 80-week-old female mice
- Correction: An international randomised placebo-controlled trial of a four-component combination pill (“polypill”) in people with raised cardiovascular risk
- Correction: Evaluation of lung toxicity risk with computed tomography ventilation image for thoracic cancer patients
- Retraction: Pathological Roles of Interleukin-22 in the Development of Recurrent Hepatitis C after Liver Transplantation
- Correction: Elevational Distribution and Ecology of Small Mammals on Tanzania's Second Highest Mountain
- Correction: Decreased breast cancer-specific mortality risk in patients with a history of thyroid cancer
- Correction: Fecal microbiota dysbiosis in macaques and humans within a shared environment
- Correction: The center of pressure and ankle muscle co-contraction in response to anterior-posterior perturbations
- PLOS One
- Archív čísel
- Aktuálne číslo
- Informácie o časopise
Najčítanejšie v tomto čísle- A daily diary study on maladaptive daydreaming, mind wandering, and sleep disturbances: Examining within-person and between-persons relations
- Pathways to conspiracy: The social and linguistic precursors of involvement in Reddit’s conspiracy theory forum
- A 3’ UTR SNP rs885863, a cis-eQTL for the circadian gene VIPR2 and lincRNA 689, is associated with opioid addiction
- A substitution mutation in a conserved domain of mammalian acetate-dependent acetyl CoA synthetase 2 results in destabilized protein and impaired HIF-2 signaling
Prihlásenie#ADS_BOTTOM_SCRIPTS#Zabudnuté hesloZadajte e-mailovú adresu, s ktorou ste vytvárali účet. Budú Vám na ňu zasielané informácie k nastaveniu nového hesla.
- Časopisy