-
Články
- Časopisy
- Kurzy
- Témy
- Kongresy
- Videa
- Podcasty
- Kariéra
HLA-B locus products resist degradation by the human cytomegalovirus immunoevasin US11
Authors: Cosima Zimmermann aff001; Daniel Kowalewski aff003; Liane Bauersfeld aff001; Andreas Hildenbrand aff001; Carolin Gerke aff001; Magdalena Schwarzmüller aff001; Vu Thuy Khanh Le-Trilling aff006; Stefan Stevanovic aff003; Hartmut Hengel aff001; Frank Momburg aff007; Anne Halenius aff001
Authors place of work: Institute of Virology, Medical Center University of Freiburg, Freiburg, Germany aff001; Faculty of Medicine, University of Freiburg, Freiburg, Germany aff002; Department of Immunology, Interfaculty Institute for Cell Biology, University of Tübingen, Tübingen, Germany aff003; Spemann Graduate School of Biology and Medicine (SGBM), University of Freiburg, Freiburg, Germany aff004; Faculty of Biology, University of Freiburg, Freiburg, Germany aff005; Institute for Virology, University Duisburg-Essen, Essen, Germany aff006; Clinical Cooperation Unit Applied Tumor Immunity, Antigen Presentation and T/NK Cell Activation Group, German Cancer Research Center, Heidelberg, Germany aff007
Published in the journal: HLA-B locus products resist degradation by the human cytomegalovirus immunoevasin US11. PLoS Pathog 15(9): e32767. doi:10.1371/journal.ppat.1008040
Category: Research Article
doi: https://doi.org/10.1371/journal.ppat.1008040Summary
To escape CD8+ T-cell immunity, human cytomegalovirus (HCMV) US11 redirects MHC-I for rapid ER-associated proteolytic degradation (ERAD). In humans, classical MHC-I molecules are encoded by the highly polymorphic HLA-A, -B and -C gene loci. While HLA-C resists US11 degradation, the specificity for HLA-A and HLA-B products has not been systematically studied. In this study we analyzed the MHC-I peptide ligands in HCMV-infected cells. A US11-dependent loss of HLA-A ligands was observed, but not of HLA-B. We revealed a general ability of HLA-B to assemble with β2m and exit from the ER in the presence of US11. Surprisingly, a low-complexity region between the signal peptide sequence and the Ig-like domain of US11, was necessary to form a stable interaction with assembled MHC-I and, moreover, this region was also responsible for changing the pool of HLA-B ligands. Our data suggest a two-pronged strategy by US11 to escape CD8+ T-cell immunity, firstly, by degrading HLA-A molecules, and secondly, by manipulating the HLA-B ligandome.
Keywords:
Biology and life sciences – Cell biology – Genetics – Gene expression – Biochemistry – Nucleic acids – Organisms – Research and analysis methods – Gene regulation – Cellular types – Animal cells – Anatomy – Medicine and health sciences – Microbiology – Medical microbiology – Microbial pathogens – Pathology and laboratory medicine – Pathogens – Small interfering RNAs – RNA – Non-coding RNA – Viral pathogens – viruses – immunology – Blood cells – White blood cells – T cells – Cytotoxic T cells – immune cells – Spectrum analysis techniques – Spectrophotometry – Cytophotometry – Flow cytometry – DNA viruses – Herpesviruses – Biological cultures – Cell cultures – Cultured tumor cells – Connective tissue cells – Fibroblasts – Biological tissue – Connective tissue – Cell lines – Precipitation techniques – Immunoprecipitation – human cytomegalovirus – HeLa cells – Co-immunoprecipitation
Introduction
Human cytomegalovirus (HCMV) represents a prototypic β-herpesvirus persisting throughout life in its host with periodic phases of latency and reactivation of productive infection. Despite rare cases of clinical disease in healthy individuals, HCMV has a permanent impact on immune cells, e.g. resulting in the extraordinary expansion of both CD8+ memory T-cells and memory-like NK cells [1, 2]. As demonstrated in CMV animal models, protection from CMV disease is strongly dependent on MHC class I (MHC-I) restricted CD8+ T-cell responses [3].
MHC-I molecules are dimers formed by the membrane attached heavy chain (HC) and the soluble beta-2-microglobulin (β2m). Upon assembly in the ER the heterodimeric MHC-I molecule is recruited to the peptide loading complex (PLC), composed of the transporter associated with antigen processing (TAP) and the chaperones tapasin, ERp57 and calreticulin [4, 5]. In the course of loading an optimal peptide, the trimolecular MHC-I complex is released for transport through the secretory pathway and surface expression.
The US6 gene family region of HCMV encodes for several immunoevasins that target the MHC-I antigen presentation pathway at different stages of the protracted HCMV replication cycle [6]. US3 blocks maturation of MHC-I and interferes with tapasin function, US2 and US11 target MHC-I for rapid proteasomal degradation, and US6 inhibits peptide translocation by TAP [7–13].
Of the reported HCMV encoded MHC-I inhibitors, so far a crystal structure exists only for US2 in complex with HLA-A*02 : 01 [14]. Similar to US2, US11 binds to MHC-I with its ectodomain, but the contact site on MHC-I has not been defined [15, 16]. The lack of insight into the contacts sites is mirrored by the poor understanding of the HLA allotype specificity of US11. Whereas varying effects of US11 on HLA-B and -C allotypes have been reported [17–20], consistent downregulation of HLA-A allotypes was observed [19–21].
HLA-A*02 : 01 has been an instrumental substrate to elucidate ER associated degradation (ERAD) pathways activated by US11. Upon binding to MHC-I, a glutamine in the transmembrane segment of US11 recruits Derlin-1 [15, 22]. Derlin-1 is a crucial component of an ERAD pathway also including the recently identified E3 ligase TMEM129 and the E2 ligase Ube2J2, required for ubiquitination and subsequent degradation of MHC-I [23, 24]. Whereas US11 itself is not degraded by this pathway, low MHC-I expression exposes US11 to an alternative degradation pathway including HRD1 and SEL1L [24, 25].
The genes of the US6 family most likely evolved in a cytomegalovirus ancestor prior to the split of Old World monkeys and hominoids, as homologs of these genes are found also in chimpanzee and rhesus CMV (rhCMV) [26, 27]. In the context of a rhCMV vaccine vector [28], in addition to degradation of MHC-I, it was observed that the rhCMV US11 homolog Rh189 is able to suppress the CD8+ T-cell responses to canonical epitopes [29]. Although the data are not formally published, Früh and Picker mention in a recent overview publication that substitution of Rh189 with HCMV US11 in a rhCMV mutant maintains the ability of the virus to block canonical CD8+ T-cell responses [28], suggesting that in addition to MHC-I degradation, US11 proteins execute further manipulation of MHC-I antigen presentation.
When studying the MHC-I ligandome in HCMV-infected cells, we noticed a striking differential effect of US11 on HLA class I locus products. Ligands from HLA-B and -C molecules remained largely unaltered in the presence of US11, while HLA-A ligands were efficiently eliminated. Further investigations reported here revealed that US11 targets HLA-B by manipulating the quality of the peptide ligands. This illustrates the specific role of a single MHC-I immunoevasin that not randomly degrades MHC-I molecules, but has evolved to exert HLA locus-specific functions.
Results
US11 diminishes HLA-A but not HLA-B specific peptides in HCMV-infected MRC-5 fibroblasts
To gain deeper insight into the identity and amount of HCMV peptides presented by MHC-I we undertook MHC-I ligandome analysis. MRC-5 fibroblasts were infected with HCMV AD169VarL strain derived mutants lacking either the MHC-I inhibitor region US2-US6 (ΔUS2-6) or US2-US6 plus US11 (ΔUS2-6/US11), leaving the US7-US10 region intact as demonstrated by the expression of the neighboring gene US10 in ΔUS2-6/US11 infected cells (S1 Fig). At 48 h.p.i. cells were harvested and MHC-I complexes were isolated by the pan-MHC-I-reactive monoclonal antibody W6/32. Identification and relative quantification of HLA ligands was performed by LC-MS/MS. Much to our surprise, a clear difference in the ability of US11 to target HLA-A and HLA-B molecules was observed. About 90% of all peptide ligands significantly down-regulated by US11 (ca 22% of total pool; Fig 1A, blue dots) was derived from HLA-A*02 : 01 and A*29 : 02 molecules (Fig 1B, left panel). Unexpectedly, some peptides (ca 11% of the total pool) were found to be increased in cells infected with the ΔUS2-6 mutant (Fig 1A, red dots). The majority (ca 80%) of these peptides could be attributed to HLA-B*44 : 02 (Fig 1B, right panel). No major changes were observed for the ligandome of HLA-B*07 : 02. To reassure that our observations were not distorted by ligands from uninfected cells possibly present in the culture, we analyzed the anchor residues of identified HCMV-derived peptides to predict their HLA-I specificities. The distribution of these viral peptides showed the same HLA-I pattern as the total ligandome, but more pronounced; US11 almost completely abolished viral ligands of HLA-A, but not of HLA-B. Again, HLA-B*44 : 02 ligands increased in the presence of US11 (S2B Fig).
Fig. 1. Changes in the relative abundance of HLA class I ligands in HCMV-infected fibroblasts.
Since the protocol for ligandome analysis does not differentiate between surface and intracellular MHC-I molecules we next conducted flow cytometry analysis of MRC-5 fibroblasts mock treated or infected with the ΔUS2-6 or ΔUS2-6/US11 deletion viruses, to determine the surface levels of HLA-A and HLA-B using available specific antibodies for HLA-A*02 : 01, B*07 : 02 and B*44 : 02. Whereas less than two-fold reduction for HLA-B surface expression was observed (Fig 1C and 1D), HLA-A*02 : 01 was reduced 3-fold in the presence of US11 as compared to infection with the virus lacking US11. Therefore, also on the surface on HCMV-infected fibroblasts, a stronger effect of US11 was measured for the HLA-A allotype A*02 : 01 than for the HLA-B allotypes B*07 : 02 and B*44 : 02. Stronger regulation of HLA-A*02 was also observed on ARPE19 epithelial cells infected with the TB40 derived ΔUS2-6 BAC virus. Compared to mock-treated cells HLA-A*02 was downregulated 5-fold and HLA-B*07 1.5-fold (S1E Fig), indicating that different regulation of HLA-A*02 : 01 and HLA-B*07 : 02 by US11 is not a fibroblast adapted function of HCMV.
We wondered whether the strong resistance of HLA-B*07 : 02 would also hold true in the context of non-infected cells and therefore N-terminally HA-tagged (HA-tagged molecules are indicated with ~ in all following figures) HLA-A*02 : 01, A*03 : 01, B*07 : 02 and CD99 were cloned into a lentiviral vector. HeLa cells were first transduced and selected to express the MHC-I molecules or the control protein CD99 and subsequently transduced with a lentivirus encoding US11 in front of an IRES and EGFP sequence. Cell surface expression of HA-tagged MHC-I and CD99 was analyzed on EGFP positive cells in comparison to EGFP negative cells at 0, 24 and 48 h after transduction. Remarkably, in this context, similarly to the control protein CD99, HLA-B*07 : 02 appeared completely unaffected by US11, but not HLA-A*02 : 01 and A*03 : 01 (Fig 1E), demonstrating that resistance of HLA-B*07 : 02 against US11 is independent of other viral or virally induced proteins. In infected cells, US11 may work in concert with other proteins and could explain the stronger effect of US11 on HLA-B in infected MRC-5 cells. HCMV also reorganizes the secretory pathway in infected cells [30], which could further influence trafficking and surface expression of MHC-I allotypes in the presence of US11.
HLA-B allotypes can escape US11-mediated degradation
To gain insight into the breadth of the resistance of HLA-B locus products against US11, we cloned various HLA-A and -B sequences with an N-terminal HA-tag und analyzed the cell surface level in the absence and presence of US11 after transient transfection of HeLa cells. Usage of the CMV major IE promoter for MHC-I expression leads to only low level of MHC-I regulation (probably due to overload of the ER and insufficient levels of ERAD-associated proteins required for US11 function) and we therefore proceeded with a different vector harboring a less potent promoter (spleen focus-forming virus (SFFV) U3 promoter) to be able to measure an adequate level of US11-mediated downregulation. Using this approach, all HLA-A allotypes were strongly downregulated by US11 (Fig 2A and 2B), while no significant reduction of HLA-B cell surface expression was noted. However, HLA-B*44 : 02, from which more diverse peptide ligands were eluted in the presence of US11 in infected cells (Fig 1B, right panel), displayed an induced level of surface expression in US11-expressing cells. Altogether, this suggests that the observed resistance towards US11-mediated downregulation is a general feature of HLA-B locus products.
Fig. 2. HLA locus specific downregulation by US11.
Next, pulse-chase experiments were conducted to measure the stability of MHC-I molecules in the absence and presence of US11. As expected, a clear destabilization of HLA-A*02 : 01 and A*03 : 01 could be observed. Surprisingly, also the stability of HLA-B HCs was strongly reduced in the presence of US11 (Fig 2C and S4 Fig, using shorter labeling and chase times). However, in contrast to HLA-A, HLA-B allotypes were able to dimerize with β2m in the presence of US11 and maturation of these molecules could be observed as a slightly slower migrating HC band (likely due to glycan modifications) at 45 min of chase (Fig 2C). This observation suggests, that different from HLA-A, HLA-B molecules are able to exit the ER and accumulate at the cell surface in the presence of US11. We therefore analyzed the steady-state level of EndoH (Endoglycosidase H; digests Asn-linked glycans that have not been subjected to modification in the Golgi apparatus) resistant molecules by Western blot and indeed observed that although the total level of HLA-B was reduced in the presence of US11, the EndoH resistant molecules were largely unchanged compared to control cells. This was not the case for HLA-A, as a complete loss of EndoH resistant molecules was observed (Fig 2D). We asked whether HLA-B surface expression in the presence of US11 could be more readily recognized by an inhibitory MHC-I receptor such as LIR1. Indeed, LIR1-Fc incubated with HeLa cells treated as described above showed a clear binding to HLA-B*07 : 02 expressing cells despite co-transfection of US11, whereas this was not the case for HLA*02 : 01 and -A*03 : 01 expressing cells (Fig 2E).
In conclusion, HLA-A and also HLA-B molecules are targets for US11-mediated degradation. However, different from HLA-A, a fraction of the HLA-B molecules can escape degradation and be expressed on the cell surface.
US11 binds both HLA-A and HLA-B molecules
In the pulse-chase experiment we observed an apparent co-immunoprecipitation of US11 with all studied types of MHC-I molecules (S3 and S4 Figs). This suggested that although HLA-B molecules escape downregulation by US11, they are still bound by US11 efficiently. To depict this more clearly, we took advantage of the fact that MHC-I molecules expressed transiently from a strong promoter (CMV IE promoter) remain largely stable in the presence of US11. Under these conditions we assessed binding of US11 to HLA-A*02 : 01, A*03 : 01, B*07 : 02 and B*15 : 03 (Fig 3A). With US11 and MHC-I being strongly overexpressed at saturating levels, US11 bound similarly to all MHC-I molecules.
Fig. 3. Analysis of factors that could affect HLA-B resistance against US11.
We next assessed the possibility that the cytosolic tail of HLA-A allotypes, which is three residues (CysLysVal) longer than that of HLA-B allotypes, could be decisive for differential US11 regulation. The C-terminal Val has previously been described to be important for US11-mediated degradation [31]. To this end, we constructed an HLA-A*03 : 01 mutant without these residues (A3ΔCKV) and compared it to the reciprocal HLA-B*07 : 02 mutant (B7+CKV). The residues CysLysVal had only small and non-significant effects on surface expression in US11 expressing cells as measured by flow cytometry (Fig 3B and 3C). Even though HLA-B*07 was more efficiently downregulated, when expressed with C-terminal CysLysVal residues, downregulation was significantly different from HLA-A*03 : 01. Therefore, the C-terminal CysLysVal residues are not the major determinant for the difference in US11-mediated regulation.
We next scrutinized with the analysis of the role of β2m in the process of US11-mediated degradation, since the HLA-B molecules B8 and B5 were reported to possess a higher affinity for β2m compared to A1 and A2 [32]. In FO-1 cells MHC-I is not expressed on the surface due to lack of β2m. Co-transfection of a plasmid encoding β2m rescued cell surface expression of MHC-I (Fig 3D). Similarly to HeLa cells, in FO-1 cells transfected with a β2m encoding plasmid, HLA-A*03 : 01 was downregulated by US11, whereas HLA-B*07 : 02 was not (Fig 3D). Also the stability of HLA-B*07 : 02 was higher compared to A*03 : 01, and this was not influenced by β2m (Fig 3E), implying that the resistance of HLA-B against US11 is conferred at the stage of unassembled HC.
In conclusion, although US11 binding to HLA-B is preserved, downregulation of HLA-B is much less efficient and this is only partly due to the shorter cytosolic tail of HLA-B alloforms.
The N-terminal low-complexity region of US11 confers binding to MHC-I/β2m heterodimers and ER retention
In our previous studies of the PLC composition in HCMV-infected cells [33], co-immunoprecipitation experiments suggested that US11 interacts with MHC-I as part of the the PLC. This was unexpected, as the concept for MHC-I targeting by US11 has been a rapid degradation facilitated by ERAD. However, in light of our observation, that HLA-B molecules display intrinsic resistance against US11-mediated degradation, we supposed that US11 pursues two different strategies when interacting with HLA-A and HLA-B, respectively. To re-investigate our earlier findings, MRC-5 fibroblasts were treated with siRNA targeting US11 (S7A Fig) or control siRNA and subsequently infected with the ΔUS2-6 HCMV deletion mutant. At 24 h p.i. a co-immunoprecipitation experiment was performed using W6/32 or anti-ERp57 antibodies. As expected, a band corresponding to the size of US11 was found in complex with both MHC-I and ERp57, which was not present in US11 siRNA treated cells (Fig 4A). To confirm the identity of the co-immunoprecipitated protein, MRC5 cells were mock treated or infected with the HCMV deletion mutants ΔUS2-6 and ΔUS2-6/US11 and a re-immunoprecipitation was performed. After dissociation of proteins immunoprecipitated with an anti-ERp57 antibody, an anti-US11 antiserum was applied. A protein, the size of US11, was co-immunoprecipitated from the ΔUS2-6 sample, but not from the ΔUS2-6/US11 sample (Fig 4B), strongly indicating that US11 interacts with the PLC in HCMV infected cells. Therefore, our data imply, that US11 binds both unassembled MHC-I HCs and, in addition, MHC-I assembled in the PLC. Possibly, US11 binds to a structure of MHC-I that is not changed during the transition from unassembled to assembled forms, e.g. in the alpha-3 domain. Alternatively, US11 interacts with MHC-I in different manners, one that can target the unassembled MHC-I for degradation and another that leads to a prolonged interaction with assembled MHC-I in the PLC.
Fig. 4. US11 co-immunoprecipitation with the PLC in HCMV-infected cells.
In this regard we found it interesting, that US11 has a predicted low-complexity region (LCR; amino acids 28–42 [34]) N-terminal of the Ig-like domain. Since LCRs tend to be engaged in protein-protein interactions [35], we set out to investigate the importance of this domain for US11 function and interaction with MHC-I. To this end, we deleted the N-terminus (amino acids 20–44 of the full-length protein) with the LCR of US11 wild-type and of a US11 Gln192Ala (US11Q/A) mutant (schematic illustration in Fig 5A). The Gln192Ala mutation prevents the recruitment of Derlin-1 and subsequent MHC-I degradation, which leads to retention of MHC-I in the ER [22]. Therefore this modification of US11 allows for interaction studies, circumventing the issue of losing substrates due to degradation. The HA-tagged US11 versions were stably transduced into HeLa cells and the cells were first checked for steady-state level expression of US11 and MHC-I. In the analysis we included HeLa cells expressing US6 and US3 to control for strong block of MHC-I peptide loading and retention, respectively. Lysates from these cells were subjected to Western blot analysis. The total level of MHC-I was strongly reduced in both US11 and ΔLCRUS11 expressing cells, suggesting that the US11 LCR is dispensable for degradation of MHC-I (Fig 5B). The expected rescue of MHC-I expression was detected in cells expressing the US11 Q192A mutants. Flow cytometry analysis revealed, that surface expression of MHC-I was downregulated both by US11 and ΔLCRUS11 to the same extent as by US6 (Fig 5C). Expression of the US11 Q192A mutants lead to lower level of MHC-I downregulation, also when compared to US3 expressing cells, indicating that the retention is not as strong as for US3. To analyze interactions between US11, MHC-I and the PLC in more detail, we next performed co-immunoprecipitation experiments using metabolically labeled cells. (Fig 5D; immunoprecipitation using an anti-transferrin receptor control antibody is shown in S8 Fig). Whereas the LCR was dispensable for US11-dependent degradation of MHC-I molecules in the context of these stable cell lines (compare MHC-I HC levels in Fig 5D, lanes 11, 12, and 13), MHC-I ER retention caused by the Q192A mutation (compare the level of EndoH sensitive MHC-I HC in lanes 11, 14 and 15) and stabilization of MHC-I in the PLC (compare the level of MHC-I HC in lanes 6, 9 and 10 as well as in lanes 16, 19, and 20) was dependent on the LCR, as the mentioned effects was only observed by the full-lengh US11Q/A mutant, but not by ΔLCRUS11Q/A. This difference in function correlated with co-immunoprecipitation of the US11 mutants: US11Q/A co-immunoprecipitated with W6/32 (lane 14), anti-tapasin (lane 9) and anti-ERp57 antibodies (lane 19). Most convincingly, a weak co-immunoprecipitation of wildtype US11 was observed with anti-tapasin (lane 7) and anti-ERp57 antibodies (lane 17), despite very low MHC-I level in these samples, while no co-immunoprecipitation of ΔLCRUS11Q/A was observed by any of the PLC or MHC-I reactive antibodies.
Fig. 5. The N-terminal LCR of US11 is required for MHC-I ER retention but not for degradation.
In contrast, ΔLCRUS11Q/A could be detected in association with unassembled HCs when using the mAb HC10 for immunoprecipitation, which predominantly binds to free HCs (Fig 5E, lane 9; of note, HC10 also immunoprecipitates HLA-A*68 : 02 HC [36, 37]). This is consistent with the finding that US11 lacking the LCR is still able to mediate degradation of MHC-I HCs. Moreover, we observed that the affinity of US11 for fully assembled MHC-I, which are recognized by the mAb W6/32, was strongly reduced (compare US11 co-immunoprecipitation in Fig 5E, lanes 5 and 8; long exposure in S9 Fig), and this was even more pronounced for the ΔLCRUS11 mutant, demonstrating that US11 interacted with unassembled and assembled MHC-I in different manners. In conclusion, in stably transduced cells US11 interacts with unassembled MHC-I HCs and redirect them for degradation independently of the N-terminal LCR. If, however, the recruitment of ERAD is prohibited by the US11 Q192A mutation, US11 remains in a complex with assembled MHC-I molecules that are bound to the PLC and retained in the ER. This ability of US11 is dependent on the LCR, since in ΔLCRUS11Q/A expressing cells, MHC-I molecules matured as in control cells. The findings are summarized in a schematic Table in the supplementary material (S10 Fig).
An additional observation from this experiment that appeared contradictory, was the lack of resistant MHC-I molecules in cells stably expressing US11. However, in contrast to low MHC-I expression levels in these HeLa cells, MHC-I is massively induced upon HCMV infection [33]. To obtain expression levels comparable to infected cells, we treated the US11-expressing cells with IFNγ. Under these conditions MHC-I was more readily detectable even in the presence of US11 (Fig 6A, lane 4). In control HeLa cells, the lower MHC-I HC band (red asterisk) appeared stronger after IFNγ induction than the upper band (blue asterisk), whereas in US11-expressing cells the lower band was weaker than the upper one. This strongly suggests that the lower MHC-I molecule is more sensitive to degradation. To determine the identity of the MHC-I HC bands, HA-tagged versions of the single HLA-A, -B and -C molecules expressed in HeLa cells (HLA-A*68 : 02, B*15 : 03, and C*12 : 03) [38], were expressed by transient transfection and subsequently their SDS-PAGE separation properties were determined after immunoprecipitation (Fig 6B). The obtained pattern suggests that the lower US11 sensitive MHC-I HC corresponds to HLA-A*68 : 02. The upper band that was more resistant to US11 appeared as a smear and could comprise both HLA-B*15 : 03 and C*12 : 03. In conclusion, under conditions of a high US11/MHC-I ratio, US11 selectivity is less pronounced. Elevated levels of MHC-I leads to a distinct preference of US11 for degradation of HLA-A.
Fig. 6. Resistant HLA-B in cells ectopically expressing US11.
(A) Stable HA-US11-HeLa cells (~US11) or control cells (-) were treated for 36 h with IFN-γ (500 U/ml) or left untreated. Cells were labeled with [35S]-Met/Cys for 2 h and an immunoprecipitation was performed using indicated antibodies. A representative of two independent biological replicates with similar outcomes is shown. (B) Hela cells were transiently transfected with HA-tagged MHC-I encoded by the pUC-IP vector. At 20 h post-transfection an immunoprecipitation experiment as described in (A) was performed.
The US11 LCR influences peptide loading of HLA-B*15 : 03
Our data shows that US11 binds to MHC-I HCs and redirects them for proteasomal degradation independently of the LCR. We asked what could be the purpose of the LCR in complex with assembled MHC-I. The PLC not only maintains empty or suboptimally loaded assembled MHC-I molecules in a peptide-receptive state, but also selects peptides with stabilizing properties [39–41]. To clarify the role of US11 in the PLC, we next investigated whether US11 can influence peptide selection. To this end, the MHC-I ligandome of HeLa cells overexpressing US11Q/A, ΔLCRUS11Q/A, or US3 was compared to non-transduced control cells. US3 was included as a control because it retains MHC-I in the ER and was reported to interact with the PLC [10, 13, 42]. The ligandome was determined by LC-MS/MS after isolation of MHC-I by the mAb W6/32 and elution of peptides [43]. The stable cell lines were analyzed in two replicates, the results of which clustered tightly. For better binding prediction, only 9-mer peptides were used for further analysis and assigned as ligands of HLA-A*68 : 02 or B*15 : 03 if their affinities were predicted to be <500 nM by NetMHC3.4 [44]. If a ligand was classified as a binder to both MHC-I molecules, it was assigned as a ligand to the one for which a higher affinity was predicted.
Very similar amount of ligands were found for HLA-A*68 : 02 and HLA-B*15 : 03 in control cells (42–45% each of all 9-mers, Table 1 and Fig 7A). In transduced cells (US11Q/A, ΔLCRUS11Q/A, US3), however, the percentage of HLA-B*15 : 03 derived ligands decreased (28–33% of all 9-mers), pointing to an advantage for HLA-A*68 : 02 expression or loading in the transduced cells. Changes in MHC-I antigen presentation upon lentiviral transduction has been observed also by others [45]. In US11Q/A expressing cells the overall amount of 9-mer ligands was strongly reduced compared to the other samples (Table 1), suggesting that US11Q/A impaired proper peptide loading. Of note, this was not the case for HeLa cells expressing ~ΔLCRUS11Q/A or US3.
Fig. 7. Anchor residue usage of HLA-B ligands is modified by US11.
Tab. 1. Number of 9-mer MHC-I ligands isolated from HeLa cell lines.
To gain a more detailed view of the effect of ~US11Q/A on MHC-I peptide loading, the usage of ligand anchor residues was compared between HeLa cell lines. HLA-B*15 : 03 prefers ligands with a lysine or glutamine at position 2 (P2) and a tyrosine or phenylalanine at the C-terminal position (P9). While no change in the usage of the P9 anchor residues was observed between cells (S11 Fig, right panel), the usage frequency of lysine and glutamine at P2 was inversed in US11Q/A expressing HeLa cells (Figs 7B and S11, right panel). In these cells lysine was found at P2 in 15–20% of the HLA-B*15 : 03 ligands and glutamine in 37–39%, whereas in wild-type HeLa and in the other transduced cell lines, including the ~ΔLCRUS11Q/A expressing cells, lysine was the most common residue and glutamine was less frequently used; 33–41% and 23–28%, respectively. We did not detect any changes in the ligandome of HLA-A*68 : 02 (S11 Fig, left panel). These data suggest that the LCR of US11 interferes with peptide loading of distinct MHC-I molecules.
To analyze whether US11 affects the MHC-I ligandome also in HCMV infected cells, we used the data sets from Fig 1. However, no clear changes in the HLA-B*07 : 02 and B*44 : 02 ligandomes were observed when we compared the cells infected with ΔUS2-6 (US11pos) and ΔUS2-6/US11 (US11neg) (S12 Fig). These HLA-B allotypes are very strict in their usage of P2 anchor residues with a high frequency of proline at P2 in B*07 : 02 peptides and glutamic acid at P2 in B*44 : 02 peptides and might therefore be more resistant to US11-mediated peptide modification. To better visualize possible changes, the ligandomes were divided into pools of common and unique peptides in the ΔUS2-6 (US11pos) and ΔUS2-6/US11 (US11neg) samples (S13A Fig). Using this setting, we found that unique HLA-B*07 : 02 peptides in the ΔUS2-6 (US11pos) pool varied at P1, but not much at P3 (Figs 7C and S13B) compared to the common pool. Interestingly, unique HLA-B*07 : 02 peptides in the ΔUS2-6/US11 (US11neg) pool showed an opposite effect at P1, emphasizing that the effect is US11-specific. Regarding HLA-B*44 : 02, only three unique peptides could be defined in the ΔUS2-6/US11 (US11neg) pool (S13A Fig) and therefore changes in the ligandome could not be strengthened by this group of peptides. However, we observed that the commonly used proline at P4 [46] was reduced by US11 and instead usage of glutamate was increased. As only a few HLA-A peptides were detected in the ΔUS2-6 (US11pos) unique pool (18 and 15 for A*02 : 01 and A*29 : 02, respectively) this data set could not be applied conclusively for analysis of peptide modification. The increased frequency of glutamate at P2 in HLA-A*29 : 02 ligands of the ΔUS2-6 (US11pos) unique pool is, nonetheless, an interesting observation (S14 Fig, right panel).
Discussion
The human cytomegalovirus is the largest of all human herpesviruses, both with respect to its genome length and numbers of transcribed ORFs [47]. Whereas all herpesviruses interfere with the host immune defense at some level, the unique infection biology of cytomegaloviruses has come along with the evolution of a large array of highly specialized immune evasive genes and reprogramming of multiple immune functions without compromising the human host [48]. HCMV controls distinct checkpoints of the MHC-I antigen presentation pathway by at least five gene products [6, 49] and most likely even more genes are involved in a less defined manner [33, 50–52]. The human immune system can cover the presentation of a wide breadth of pathogen derived antigens owing to the three extraordinary polymorphic MHC-I genes each individual possesses. This unique and continuing diversification of human HLA may have promoted the emergence of multiple HCMV genes blocking MHC-I antigen presentation. Obviously, it would be less strategic to attack the MHC-I pathway only at a checkpoint shared by all HLA gene products since they display differential immunological impacts. Nevertheless, so far, specificities for representative alloforms of HCMV encoded inhibitors have not been comprehensively studied. Here, we show that a prime target for US11-mediated degradation is HLA-A locus products, whereas HLA-B resists this effect. Instead, US11 has acquired an independent function in its N-terminal LCR to manipulate peptide loading of HLA-B molecules (model in Fig 8).
Fig. 8. Model for US11 regulation of HLA-A and HLA-B.
The HC of MHC-I dimerizes with β2m and is recruited to the PLC, where peptide (green) loading takes place. The stabilized MHC-I/peptide complex leaves the PLC for cell surface expression through the secretory pathway. In the presence of US11 (yellow), MHC-I molecules are redirected for proteasomal degradation via an ERAD pathway. This function can be executed by US11 also without the LCR. HLA-B HCs comprise an intrinsic resistance against US11-mediated degradation and dimerize more efficiently with β2m in the presence of US11. In an LCR-dependent manner US11 modifies peptide (orange) loading. The relative effect of US11 on HLA-A and HLA-B is depicted with arrows, the thickness of which is indicative of the efficacy of degradation (red) and surface expression (black).
Advancements in mass spectrometry analysis [53] encouraged us to analyze the MHC-I ligandome of HCMV-infected MRC-5 fibroblasts. The primary aim was to identify novel CD8+ T-cell restricted epitopes (Lübke et al., manuscript submitted). During these studies we came across a remarkable phenomenon regarding US11: whereas the quantity of HLA-A allotype (HLA-A*02 : 01, A*29 : 02)-derived peptides was reduced by US11 as expected, this was not the case for the HLA-B (HLA-B*07 : 02, B*44 : 02) and -C (HLA-C*05 : 01, C*07 : 02) ligandomes. This effect even more pronounced when only HCMV derived MHC-I ligands were considered. Flow cytometry measurements of infected fibroblast and epithelial cells, demonstrated that US11 slightly reduced the level of HLA-B*07 : 02 surface expression, however, this was much less pronounced as compared with HLA-A*02 : 01. Altogether, this indicates that in HCMV-infected cells US11 is not able to degrade HLA-B efficiently. The observed higher US11-resistance by HLA-B is in agreement with recent observations of HCMV-infected cells [54, 55] and plasma membrane profiling studies of THP-1 cells expressing US11 [19].
HLA-B molecules dimerize with β2m and mature in the presence of US11
To assess the effect of US11 on a larger panel of various MHC-I molecules, we elaborated a convenient and fast flow cytometry based assay system measuring MHC-I cell surface disposition after transient transfection of HeLa cells (Fig 2A and 2B). MHC-I molecules were designed to express an inert HA-epitope tag at the N-terminus to overcome the need for allotype-specific antibodies. In this way, we measured unrestricted expression of HLA-B allotypes on the cell surface, whereas HLA-A allotypes were strongly reduced.
Unexpectedly, we observed in pulse-chase experiments that US11 substantially affected HLA-B expression in the early secretory pathway (Fig 4C), despite the unchanged density on the cell surface. However, at variance with HLA-A locus products, HLA-B alloforms were able to dimerize with β2m and mature in the presence of US11. HLA-B molecules thus escaped US11 and accumulated on the surface to the same extent as in US11-negative cells. The functional expression of HLA-B*07 : 02 in the presence of US11 could be further demonstrated by binding to LIR1.
Furthermore, we found that the level of polymorphic MHC-I synthesized in the ER strongly affects the efficacy and selectivity of US11-mediated degradation. In HCMV-infected cells transcription and biosynthesis of MHC-I is highly upregulated [33]. This could explain why US11 does not reach the critical level required to degrade HLA-B, while HLA-A is still efficiently recruited to ERAD, as we observed also in IFNγ-induced HeLa cells stably expressing US11. This underlines the relevance of the strict regulation of US11 expresssion via the HRD1-dependent autoregulatory loop [24, 25]; in the absence of MHC-I substrates US11 itself is targeted to ERAD degradation, controlled by HRD1.
We have begun to address the molecular basis of HLA-B resistance. The shorter cytosolic tail of HLA-B alleles confers some level of resistance, as described previously for US11 [31] and also for HIV-1 encoded Nef [56], but was not a pivotal factor for US11 in our experimental setup. The results obtained with β2m-deficient FO-1 cells showed that β2m is not critically involved in resistance against degradation. Indeed, this demonstrated that this resistance should be an intrinsic property of HLA-B HCs, which is now an object of further investigation.
A molecular model for US11 LCR interaction and function
US11 possesses an LCR sequence between its signal peptide and the Ig-like luminal domain. This region is 15 amino acids long (residues 28–42) and contains seven proline residues. Such structurally undefined regions often function as multiprotein interaction hubs, e.g. found in chaperons [35]. Furthermore, LCRs may have advantages for faster adaptation and evolution [57]. Our analysis revealed that the LCR of US11 is required for several features of US11 that are possibly interconnected. Firstly, the ability of US11 to interact with folded heterodimers of MHC-I HC and β2m, as defined by recognition by the mAb W6/32 [58], is dependent on the LCR. Secondly, we found that US11 interacts with the PLC most likely via binding to MHC-I, since low MHC-I expression levels resulted in low US11 co-immunoprecipitation with the PLC. Again, this interaction was dependent on the US11 LCR, confirming that only folded heterodimeric MHC-I molecules interact with the PLC [5, 59]. US11 with a Q192A mutation is not able to forward MHC-I to the ERAD pathway. As a consequence MHC-I is retained in the ER [15, 22]. This requires a stable interaction between US11 and assembled MHC-I heterodimers that involves the LCR of US11, because deletion of the LCR rescued MHC-I transport through the secretory pathway in the context of the US11Q/A mutant. However, the ability of US11 to forward MHC-I HC for ERAD degradation is not affected by the deletion of the LCR. In cells stably expressing ΔLCRUS11 a strong reduction of MHC-I was observed, in accordance with the finding that ΔLCRUS11Q/A is still able to stably interact with unassembled MHC-I HCs. This indicates that US11 can initiate retrotranslocation and degradation of MHC-I without its LCR at a stage before heterodimeric MHC-I molecules assemble. The targeting of unassembled MHC-I in β2m deficient cells has been observed previously [60].
The most remarkable feature of the US11 LCR, however, was its ability to manipulate HLA-B*15 : 03 peptide ligands. The usage of the N-terminal P2 position of the ligand anchor residue was changed in a way that the frequently appearing lysine was strongly reduced and the generally less used glutamine emerged most frequently in the presence of US11. Control cells, ΔLCRUS11Q/A cells or cells expressing US3, which also binds to and retains MHC-I heterodimers, did not exhibit this effect on HLA-B*15 : 03, indicating that it is a specific feature of the US11 LCR that interferes with peptide loading. We observed this change only for the N-terminal anchor residues and not for the C-terminal. We were not able to define any similar changes in the ligandome of HLA-A*68 : 02.
The HLA-B molecules HLA-B*07 : 02 and B*44 : 02 present in MRC-5 fibroblast do not allow for measurable modifications at P2, since the P2 residue is strongly fixed for these molecules (by proline and glutamate, respectively). However, unique HLA-B*07 : 02 and HLA-B*44 : 02 ligands in MRC-5 cells infected with the ΔUS2-6 HCMV mutant virus expressing US11, displayed changes in the neighboring P1 and P4, respectively, suggesting that US11 influences the peptide selection for a broad range of HLA-B allotypes.
The recently resolved structure of the PLC [5] provides a molecular basis to model manipulation of HLA-B by US11. The MHC-I peptide binding groove is deeply buried in the PLC with the F-pocked that binds the C-terminal peptide anchor residue pointing inwards into the center of the PLC. The opposite side of the MHC-I HC is the only region of MHC-I still accessible for further protein interactions. This interface is also used by HCMV encoded US2 and adenovirus encoded E3-19K as demonstrated in resolved crystal structures [14, 61]. If US11 also binds to this particular surface, which is likely, since US11 interacts with MHC-I during its processing through the PLC, the LCR could be in the vicinity of MHC-I residues contributing to the formation of pockets that fix the N-terminal part of the peptide.
Whereas HLA-B allotypes are at the forefront in studies determining protective and sensitizing MHC-I in HIV and HCV infections [62, 63], such observations have not been made for HCMV or other herpes viruses. This goes well together with the suggestion that HLA-A is more important to control co-evolving DNA viruses [64]. The differential targeting of HLA-A and -B by US11 underlines this view and implies that complete block of antigen presentation by HLA-A is crucial for the virus to cope with highly specific CD8 T-cells. Unlike HLA-A, a large fraction of HLA-B allotypes contains the Bw4 motif recognized by inhibitory KIRs (Killer cell immunoglobulin-like receptors) on NK cells [65]. Therefore, the costs for allowing a reduced level of HLA-B surface expression, yet, with a modified peptide repertoire, might be tolerated by HCMV, in order to dampen NK cell activation.
Future studies will provide more insight into the mechanism how the US11 LCR alters the quality of MHC-I peptide ligands and the functional ramifications of this alteration. It is conceivable that this feature of US11 could confound CD8+ T-cell recognition of HCMV infected target cells. The initial priming of CD8+ T precursors is believed to occur via cross-presentation [66, 67], i.e. by non-infected dendritic cells in the absence of US11. Thus, the quality of the MHC-I presented peptides might differ significantly between productively HCMV-infected cells, in which US11 is actively expressed and professional APC priming the CD8+ T-cells. Whether US11 will impact the formation of memory cells and memory inflation is not predictable. However, it will be of great interest to learn whether Rh189 (RhCMV US11 homolog)-induced non-canonical CD8+ T-cell restricted epitopes [29] are also dependent on the N-terminal part of the protein and could be a result of manipulation of peptide loading. Although an LCR is not predicted in the N-terminus of Rh189, it still contains some conserved residues (S15 Fig), possibly important for interaction with assembled MHC-I.
Material and methods
Cells and transfection of plasmids and siRNA
MRC-5 fibroblasts (ECACC 05090501; HLA-A*02 : 01, A*29 : 02, B*07 : 02, B*44 : 02, C*05 : 01, C*07 : 02), HeLa (ATCC CCL-2; HLA-A*68 : 02, B*15 : 03, C*12 : 03; ATCC CCL-2), and US6-HA-HeLa cells [68], ARPE-19 (ATCC CRL-2302), the melanoma cell line FO-1 [69] and HEK293T (ATCC CRL‐11268) cells were grown in DMEM supplemented with 10% FCS, penicillin and streptomycin. HeLa cells were tranfected with Superfect (Qiagen) and FO-1 cells with Jetprime (Polyplus Transfection). Small interfering RNA (siRNA) targeting US11 (ACACUUGAAUCACUGCCACCCCC) was purchased from Riboxx. Knock-down experiments were performed using Lipofectamin RNAiMax Reagent (Invitrogen).
Viruses
The recombinant HCMV mutants ΔUS2-6/US11 and ΔUS2-US11 was generated according to a previously published procedure [70] using the BAC-cloned AD169varL genome pAD169 [71] as parental BAC. Briefly, PCR fragments was generated using the primer pair KL-DeltaUS11-Kana1 CAAAAAGTCTGGTGAGTCGTTTCCGAGCGACTCGAGATGCACTCCGCTTCAGTCTATATACCAGTGAATTCGAGCTCGGTAC and KL-DeltaUS11-Kana2 TAAGACAGCCTTACAGCTTTTG-AGTCTAGACAGGGTAACAGCCTTCCCTTGTAAGACAGAGACCATGATTACGCCAAGCTCC for the ΔUS2-6/US11 mutant and the primer pair KL-DeltaUS7-Kana1 ACCTTTTGTGCATACGGTTTATATATGACCATCCACGCTTATAACGAACCTAACAGTTTACCAGTGAATTCGAGCTCGGTAC and KL-DeltaUS11-Kana2 TAAGACAGCCTTACAGCTTTTGAGTCTAGACAGGGTAACAGCCTTCCCTTGTAAGACAGAGACCATGATTACGCCAAGCTCC for the ΔUS2-US11 mutant and the plasmid pSLFRTKn [72] as template DNA. The PCR fragment containing a kanamycin resistance gene was inserted into the parental BAC by homologous recombination in E. coli. Correct mutagenesis was confirmed by Southern blot and PCR analysis. Recombinant HCMVs including TB40/E ΔUS2-6 [73] were reconstituted from HCMV BAC DNA by Superfect (Qiagen) transfection into permissive MRC-5 fibroblasts. Virus titers were determined by standard plaque assay.
Production of lentiviruses was performed as described previously [38]. At 48 h post transfection the supernatant was collected and filtered through a 45 μm filter prior to transduction of HeLa cells by centrifugal enhancement. When selected, the cells were cultivated in normal medium for 3–4 days before treatment with 5 μg/ml puromycin (Sigma).
Antibodies
The following antibodies were applied: W6/32 (anti-pan-HLA-A,B,C assembled with β2m and peptide, [58]), BB7.2 (anti-HLA-A2 [74]), BB7.1 (anti-HLA-B7 [74]), TT4-A20 (anti-HLA-B44 [75]), HC10 and HCA2 recognizing free HLA-B/C and HLA-A heavy chains, respectively [76], anti-CD71 (immunotech), anti-CD85j (-LIR1; Miltenyi) mouse and rabbit anti-HA antibodies (Sigma), anti-ERp57 (Millipore), APC-coupled anti-mouse antibodies (BD Pharmingen). Polyclonal anti-tapasin and anti-US11 anti-sera were raised by immunization of rabbits (Genscript) with synthetic peptides (aa 418–428 and 90–103, respectively). Viral Fc-receptors were stained with FITC-coupled Fc fragment (Rockland Immunochemicals).
Molecular cloning
The tapasin signal peptide sequence was amplified on front of a human influenza hemagglutinin (HA)–tag and cloned into XhoI and PstI of pIRES-EGFP (Tpn-SP-pIRES-EGFP; CMV IE promoter). HLA-A*02 : 01, HLA-B*07 : 02, HLA-C*07 : 02, CD99 were amplified from cDNA prepared from MRC-5 cells and HLA-A*68 : 02 and HLA-B*15 : 03 from cDNA from HeLa cells. HLA-B*44 : 02 and HLA-B*44 : 05 were described previously [38]. The cDNA clones for HLA-A*01 : 01 (NM_001242758, BC003069), HLA-A*03 : 01 (NM_002116) and HLA-B*08 : 01 (AK292226, BC091497) have been purchased from Source Bioscience, Nottingham, UK. HLA-A*29 : 02 (IMGT/HLA database) was synthesized as a gBlock (Integrated DNA Technologies, Inc.) gene fragment. Irrespective of their source, all MHC I sequences were used as a template for further amplification using specific primers (Table 2). PCR products were digested with PstI or NsiI and BamHI restriction enzymes and cloned into Tpn-SP-pIRES-EGFP. Sequenced inserts were subsequently subcloned into the puc2CL6IP (pUC-IP, with spleen focus-forming virus U3 promoter) lentiviral vector [38] using the restriction sites NheI and BamHI. HA-HLA-C*12 : 03 was purchased in pcDNA3.1 from Biocat and subcloned into puc2CL6IP. US11 and US3 cDNA was amplified from AD169 HCMV DNA and cloned into pIRES-EGFP via NheI and BamH or into puc2CL6IP and puc2CL6-IRES-EGFP (pUC-EGFP) lentiviral vector using the same enzymes. Point mutation in US11 was inserted using the QuickChange II XL Site-Directed Mutagenesis Kit (Agilent) following the protocol described by the manufacturer.
Tab. 2. Primer sequences used cloning.
MHC-I ligandome analysis
MHC I ligands were isolated by standard immunoaffinity purification using the mAb W6/32 as described previously [43]. LC-MS/MS analysis of MHC ligand extracts using nanoflow HPLC (RSLCnano, Thermo Fisher) on a 50 μm × 25 cm PepMap RSLC column (Thermo Fisher) with a gradient ranging from 2.4 to 32.0% acetonitrile over the course of 90 min. Eluted peptides were analyzed in an online-coupled LTQ Orbitrap XL mass spectrometer (Thermo Fisher) using a top 5 CID (collision-induced dissociation) method. The procedure for label-free quantification (LFQ) of relative HLA ligand abundances was performed as follows: total injected peptide amounts of paired samples were normalized and LC-MS/MS analysis was performed in five technical replicates for each sample. For normalization, the relative amounts of substance in paired samples were determined by calculating the summed area of peptide identifications in dose-finding LC-MS/MS runs and the samples were adjusted accordingly by dilution. Relative quantification of HLA ligands was performed by calculating the area under the curve of the corresponding precursor extracted ion chromatograms (XIC) using ProteomeDiscoverer 1.4 (Thermo Fisher). For Volcano plots, the ratios of the mean areas of the individual peptides in the five LFQ-MS runs of each sample were calculated and two-tailed t-tests implementing Benjamini-Hochberg correction were performed using an in-house R script (v3.2). Data processing and spectral annotation was performed as described previously [77]. In brief, the Mascot search engine (Mascot 2.2.04; Matrix Science, London, UK) was used to search the human proteome as comprised in the Swiss-Prot database (20,279 reviewed protein sequences, September 27th 2013) without enzymatic restriction. Oxidized methionine was allowed as a dynamic modification. The false discovery rate was estimated using the Percolator algorithm [78] and set to 5%. Peptide lengths were limited to 8–12 amino acids for HLA class I. Protein inference was disabled, allowing for multiple protein annotations of peptides. HLA annotation was performed using NetMHC [44] (v3.4), annotating peptides with IC50 scores below 500 nM as ligands of the corresponding HLA allotype. In cases of multiple possible annotations, the HLA allotype yielding the lowest IC50 score was selected.
Flow cytometry analysis
MRC-5 and ARPE-19 cells were detached with Accutase (Sigma), treated with FcR blocking reagent as recommended by manufacturer (Miltenyi) and stained with antibodies diluted in 3% FCS/PBS. Cells were washed in 3% FCS/PBS supplemented with DAPI and fixed in 4% paraformaldehyde. Cells were analyzed by FACS Canto II (Becton Dickinson).
For analysis of MHC-I expression after transient transfection of HeLa cells US11 variants or a control pIRES-EGFP plasmid together with HA-tagged HLA-alleles or control molecules in puc2CL6IP were co-transfected using SuperFect (Qiagen). At 20 h post-transfection, cells were detached with trypsin and measured as described above. LIR-1 binding was analyzed by incubating the cells with recombinant protein [79] and subsequently incubating the cells with an APC-coupled anti-CD85j (LIR-1) antibody.
Acquired data was analyzed by FlowJo (v10.1, Tree Star Inc.). For statistical analyses Mann-Whitney U-test or one-way ANOVA followed by Tukey’s or Dunnett´s multiple comparison test were performed using the GraphPad Prism 6 Software. A p-value <0.05 was considered significant (*, p<0,05; **, p<0,005; ***, p<0,0005).
Immunoprecipitation
Immunoprecipitation was performed as described previously [38]. Briefly, cells grown in 6-well plates were washed with PBS and metabolically labeled (Easytag Express [35S]-Met/Cys protein labeling, Perkin Elmer) with 100 Ci/ml for various times. Cells were lysed in digitonin lysis buffer (140 mM NaCl, 20 mM Tris [pH 7.6], 5 mM MgCl2, and 1% digitonin (Calbiochem)) and cleared from membrane debris at 13,000 rpm for 30 min at 4°C. For analysis of lysates with several antibodies, identical lysates were pooled then split up into equal aliquots. Lysates were incubated with antibodies for 2 h at 4°C in an overhead tumbler before immune complexes were retrieved by protein A - or G-sepharose (GE Healthcare). Sepharose pellets were washed four times with increasing NaCl concentrations (0.15 to 0.5 M in lysis buffer containing 0.2% detergent). For a re-immunoprecipitation the washed beads were subsequently incubated with a lysisbuffer supplemented with 1% Igepal (Sigma) and 1% SDS at 95° C for five minutes. The lysisbuffer was diluted to reach a final concentration of 0.1% SDS and a subsequent immunoprecipitation was performed. Endoglycosidase H (New England Biolabs) treatment was performed as recommended by the manufacturer. Prior to loading onto a SDS-PAGE iImmune complexes were dissociated at 95°C for 5 min in a DTT (40 mM) containing sample buffer. Fixed and dried gels were exposed overnight to a phosphor screen, scanned by Typhoon FLA 7000 (GE Healthcare). For better visualization of the results contrast and light were adjusted. Where mentioned in the figure legend a short or long exposure to x-ray film was used for autoradiography.
Western blotting
For Western blot analysis, equal amount of cells were washed in PBS and lysed in lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Igepal, and Complete protease inhibitor (Roche)). The proteins were separated by SDS-PAGE and transferred to nitrocellulose filter. After incubation with primary antibody a peroxidase coupled secondary antibody was used and chemiluminescence was detected using a LI-COR Blot Scanner.
RNA extraction, reverse transcription, and RT-qPCR
Mock treated or infected MRC5 cells were grown in technical replicates in a 6-well format. Cells were lysed at 24 h.p.i. and total RNA was extracted using NucleoSpin kit RNA II (Macherey-Nagel) and 600ng was reverse transcribed using a QuantiTect reverse transcription kit (Qiagen) and further used for both semi-quantitative and quantitative RT-PCRs. Quantitative RT-PCRs were performed with a QuantiTect SYBR green PCR kit (Qiagen). CT values were normalized to actin (ΔCT) and plotted relative to the ΔCT values of the mock treated control cells. For the semi-quantitave analysis the following primer pairs were used: US11-ctrl3’ tggtccgaaaacatccaggg and US11-ctrl5’ ttcgatgaacctccgccctt; US10-ctrl’3 aaccgcatatcaggaggaggga and US10-ctrl’5 tcacgtgcggctgtgttattca, UL40-1 gcagctagcgccgccaccatgaacaaat and UL40-2 cgaggatcctcaagcctttttcaaggcg. For the qRT-PCR we used the primers: qUS10-1 acgacggggaaaatcacgaa and qUS10-2 cagagtagtttcggggtcgg; actin beta primers (Qiagen, Hs_ACTB_1_SG QuantiTect Primer).
Supporting information
S4 Fig [tif]
HeLa cells were transiently co-transfected with US11 or a control pIRES-EGFP plasmid (CMV major IE promoter) together with the indicated HA-tagged (~) HLA molecules expressed from the pUC-IP vector (SFFV U3 promoter).S5 Fig [tif]
Uncropped gel shown in .S6 Fig [tif]
Uncropped gel shown in .S7 Fig [a]
Efficiency of four different siRNAs directed against US11 was tested in HeLa cells stably expressing HA-tagged US11.S8 Fig [tif]
Stably transduced HeLa cells with US11 variants as indicated, were labeled with [S]-Met/Cys for 2 h and co-immunoprecipitation was performed using antibodies as indicated.S9 Fig [tif]
Longer exposure of gel shown in .S10 Fig [tif]
The schematic table depicts effects of the US11 LCR sequence.S11 Fig [tif]
Frequency of MHC-I ligand residues determined from HeLa cells.S12 Fig [tif]
Frequency of MHC-I ligand residues determined from HCMV infected cells.S13 Fig [a]
Frequency of MHC-I ligand residues determined from HCMV infected cells.S14 Fig [tif]
Frequency of HLA-A ligand residues determined from HCMV infected cells.S15 Fig [tif]
Alignment of HCMV and RhCMV US11 orthologs.
Zdroje
1. Rolle A, Brodin P. Immune Adaptation to Environmental Influence: The Case of NK Cells and HCMV. Trends in immunology. 2016;37(3):233–43. Epub 2016/02/13. doi: 10.1016/j.it.2016.01.005 26869205.
2. Waller EC, Day E, Sissons JG, Wills MR. Dynamics of T cell memory in human cytomegalovirus infection. Medical microbiology and immunology. 2008;197(2):83–96. Epub 2008/02/28. doi: 10.1007/s00430-008-0082-5 18301918.
3. Reddehase MJ, Mutter W, Munch K, Buhring HJ, Koszinowski UH. CD8-positive T lymphocytes specific for murine cytomegalovirus immediate-early antigens mediate protective immunity. Journal of virology. 1987;61(10):3102–8. Epub 1987/10/01. 3041033; PubMed Central PMCID: PMC255886.
4. Peaper DR, Cresswell P. Regulation of MHC class I assembly and peptide binding. Annual review of cell and developmental biology. 2008;24 : 343–68. Epub 2008/08/30. doi: 10.1146/annurev.cellbio.24.110707.175347 18729726.
5. Blees A, Januliene D, Hofmann T, Koller N, Schmidt C, Trowitzsch S, et al. Structure of the human MHC-I peptide-loading complex. Nature. 2017;551(7681):525–8. Epub 2017/11/07. doi: 10.1038/nature24627 29107940.
6. Halenius A, Gerke C, Hengel H. Classical and non-classical MHC I molecule manipulation by human cytomegalovirus: so many targets-but how many arrows in the quiver? Cellular & molecular immunology. 2015;12(2):139–53. Epub 2014/11/25. doi: 10.1038/cmi.2014.105 25418469.
7. Ahn K, Gruhler A, Galocha B, Jones TR, Wiertz EJ, Ploegh HL, et al. The ER-luminal domain of the HCMV glycoprotein US6 inhibits peptide translocation by TAP. Immunity. 1997;6(5):613–21. Epub 1997/05/01. 9175839.
8. Hengel H, Koopmann JO, Flohr T, Muranyi W, Goulmy E, Hammerling GJ, et al. A viral ER-resident glycoprotein inactivates the MHC-encoded peptide transporter. Immunity. 1997;6(5):623–32. Epub 1997/05/01. 9175840.
9. Lehner PJ, Karttunen JT, Wilkinson GW, Cresswell P. The human cytomegalovirus US6 glycoprotein inhibits transporter associated with antigen processing-dependent peptide translocation. Proceedings of the National Academy of Sciences of the United States of America. 1997;94(13):6904–9. Epub 1997/06/24. doi: 10.1073/pnas.94.13.6904 9192664; PubMed Central PMCID: PMC21257.
10. Jones TR, Wiertz EJ, Sun L, Fish KN, Nelson JA, Ploegh HL. Human cytomegalovirus US3 impairs transport and maturation of major histocompatibility complex class I heavy chains. Proceedings of the National Academy of Sciences of the United States of America. 1996;93(21):11327–33. Epub 1996/10/15. doi: 10.1073/pnas.93.21.11327 8876135; PubMed Central PMCID: PMC38057.
11. Wiertz EJ, Jones TR, Sun L, Bogyo M, Geuze HJ, Ploegh HL. The human cytomegalovirus US11 gene product dislocates MHC class I heavy chains from the endoplasmic reticulum to the cytosol. Cell. 1996;84(5):769–79. Epub 1996/03/08. doi: 10.1016/s0092-8674(00)81054-5 8625414.
12. Jones TR, Sun L. Human cytomegalovirus US2 destabilizes major histocompatibility complex class I heavy chains. Journal of virology. 1997;71(4):2970–9. Epub 1997/04/01. 9060656; PubMed Central PMCID: PMC191425.
13. Park B, Kim Y, Shin J, Lee S, Cho K, Fruh K, et al. Human cytomegalovirus inhibits tapasin-dependent peptide loading and optimization of the MHC class I peptide cargo for immune evasion. Immunity. 2004;20(1):71–85. Epub 2004/01/24. 14738766.
14. Gewurz BE, Gaudet R, Tortorella D, Wang EW, Ploegh HL, Wiley DC. Antigen presentation subverted: Structure of the human cytomegalovirus protein US2 bound to the class I molecule HLA-A2. Proceedings of the National Academy of Sciences of the United States of America. 2001;98(12):6794–9. Epub 2001/06/08. doi: 10.1073/pnas.121172898 11391001; PubMed Central PMCID: PMC34432.
15. Lilley BN, Tortorella D, Ploegh HL. Dislocation of a type I membrane protein requires interactions between membrane-spanning segments within the lipid bilayer. Molecular biology of the cell. 2003;14(9):3690–8. Epub 2003/09/16. doi: 10.1091/mbc.E03-03-0192 12972557; PubMed Central PMCID: PMC196560.
16. Barel MT, Pizzato N, van Leeuwen D, Bouteiller PL, Wiertz EJ, Lenfant F. Amino acid composition of alpha1/alpha2 domains and cytoplasmic tail of MHC class I molecules determine their susceptibility to human cytomegalovirus US11-mediated down-regulation. Eur J Immunol. 2003;33(6):1707–16. Epub 2003/06/05. doi: 10.1002/eji.200323912 12778489.
17. Schust DJ, Tortorella D, Seebach J, Phan C, Ploegh HL. Trophoblast class I major histocompatibility complex (MHC) products are resistant to rapid degradation imposed by the human cytomegalovirus (HCMV) gene products US2 and US11. The Journal of experimental medicine. 1998;188(3):497–503. Epub 1998/08/04. doi: 10.1084/jem.188.3.497 9687527; PubMed Central PMCID: PMC2212475.
18. Ameres S, Mautner J, Schlott F, Neuenhahn M, Busch DH, Plachter B, et al. Presentation of an immunodominant immediate-early CD8+ T cell epitope resists human cytomegalovirus immunoevasion. PLoS pathogens. 2013;9(5):e1003383. Epub 2013/05/30. doi: 10.1371/journal.ppat.1003383 23717207; PubMed Central PMCID: PMC3662661.
19. Hsu JL, van den Boomen DJ, Tomasec P, Weekes MP, Antrobus R, Stanton RJ, et al. Plasma membrane profiling defines an expanded class of cell surface proteins selectively targeted for degradation by HCMV US2 in cooperation with UL141. PLoS pathogens. 2015;11(4):e1004811. Epub 2015/04/16. doi: 10.1371/journal.ppat.1004811 25875600; PubMed Central PMCID: PMC4397069.
20. Barel MT, Pizzato N, Le Bouteiller P, Wiertz EJ, Lenfant F. Subtle sequence variation among MHC class I locus products greatly influences sensitivity to HCMV US2 - and US11-mediated degradation. International immunology. 2006;18(1):173–82. Epub 2005/12/20. doi: 10.1093/intimm/dxh362 16361314.
21. Ameres S, Besold K, Plachter B, Moosmann A. CD8 T Cell-Evasive Functions of Human Cytomegalovirus Display Pervasive MHC Allele Specificity, Complementarity, and Cooperativity. J Immunol. 2014. Epub 2014/05/09. doi: 10.4049/jimmunol.1302281 24808364.
22. Lilley BN, Ploegh HL. A membrane protein required for dislocation of misfolded proteins from the ER. Nature. 2004;429(6994):834–40. Epub 2004/06/25. doi: 10.1038/nature02592 15215855.
23. van de Weijer ML, Bassik MC, Luteijn RD, Voorburg CM, Lohuis MA, Kremmer E, et al. A high-coverage shRNA screen identifies TMEM129 as an E3 ligase involved in ER-associated protein degradation. Nature communications. 2014;5 : 3832. Epub 2014/05/09. doi: 10.1038/ncomms4832 24807418; PubMed Central PMCID: PMC4024746.
24. van den Boomen DJ, Timms RT, Grice GL, Stagg HR, Skodt K, Dougan G, et al. TMEM129 is a Derlin-1 associated ERAD E3 ligase essential for virus-induced degradation of MHC-I. Proceedings of the National Academy of Sciences of the United States of America. 2014;111(31):11425–30. Epub 2014/07/18. doi: 10.1073/pnas.1409099111 25030448; PubMed Central PMCID: PMC4128144.
25. van den Boomen DJ, Lehner PJ. Identifying the ERAD ubiquitin E3 ligases for viral and cellular targeting of MHC class I. Molecular immunology. 2015. Epub 2015/07/27. doi: 10.1016/j.molimm.2015.07.005 26210183.
26. Pande NT, Powers C, Ahn K, Fruh K. Rhesus cytomegalovirus contains functional homologues of US2, US3, US6, and US11. Journal of virology. 2005;79(9):5786–98. Epub 2005/04/14. doi: 10.1128/JVI.79.9.5786-5798.2005 15827193; PubMed Central PMCID: PMC1082751.
27. Davison AJ, Dolan A, Akter P, Addison C, Dargan DJ, Alcendor DJ, et al. The human cytomegalovirus genome revisited: comparison with the chimpanzee cytomegalovirus genome. The Journal of general virology. 2003;84(Pt 1):17–28. Epub 2003/01/21. doi: 10.1099/vir.0.18606-0 12533697. 12533697
28. Fruh K, Picker L. CD8+ T cell programming by cytomegalovirus vectors: applications in prophylactic and therapeutic vaccination. Current opinion in immunology. 2017;47 : 52–6. Epub 2017/07/25. doi: 10.1016/j.coi.2017.06.010 28734175; PubMed Central PMCID: PMC5626601.
29. Hansen SG, Sacha JB, Hughes CM, Ford JC, Burwitz BJ, Scholz I, et al. Cytomegalovirus vectors violate CD8+ T cell epitope recognition paradigms. Science. 2013;340(6135):1237874. Epub 2013/05/25. doi: 10.1126/science.1237874 23704576; PubMed Central PMCID: PMC3816976.
30. Hook LM, Grey F, Grabski R, Tirabassi R, Doyle T, Hancock M, et al. Cytomegalovirus miRNAs target secretory pathway genes to facilitate formation of the virion assembly compartment and reduce cytokine secretion. Cell host & microbe. 2014;15(3):363–73. doi: 10.1016/j.chom.2014.02.004 24629342; PubMed Central PMCID: PMC4029511.
31. Cho S, Kim BY, Ahn K, Jun Y. The C-terminal amino acid of the MHC-I heavy chain is critical for binding to Derlin-1 in human cytomegalovirus US11-induced MHC-I degradation. PloS one. 2013;8(8):e72356. Epub 2013/08/21. doi: 10.1371/journal.pone.0072356 23951315; PubMed Central PMCID: PMC3741148.
32. Hochman JH, Shimizu Y, DeMars R, Edidin M. Specific associations of fluorescent beta-2-microglobulin with cell surfaces. The affinity of different H-2 and HLA antigens for beta-2-microglobulin. J Immunol. 1988;140(7):2322–9. Epub 1988/04/01. 2450918.
33. Halenius A, Hauka S, Dolken L, Stindt J, Reinhard H, Wiek C, et al. Human cytomegalovirus disrupts the major histocompatibility complex class I peptide-loading complex and inhibits tapasin gene transcription. Journal of virology. 2011;85(7):3473–85. Epub 2011/01/21. doi: 10.1128/JVI.01923-10 21248040; PubMed Central PMCID: PMC3067861.
34. Wootton JC. Non-globular domains in protein sequences: automated segmentation using complexity measures. Computers & chemistry. 1994;18(3):269–85. Epub 1994/09/01. 7952898.
35. Coletta A, Pinney JW, Solis DY, Marsh J, Pettifer SR, Attwood TK. Low-complexity regions within protein sequences have position-dependent roles. BMC systems biology. 2010;4 : 43. Epub 2010/04/14. doi: 10.1186/1752-0509-4-43 20385029; PubMed Central PMCID: 20385029.
36. Turnquist HR, Schenk EL, McIlhaney MM, Hickman HD, Hildebrand WH, Solheim JC. Disparate binding of chaperone proteins by HLA-A subtypes. Immunogenetics. 2002;53(10–11):830–4. Epub 2002/02/28. doi: 10.1007/s00251-001-0404-x 11862383.
37. Perosa F, Luccarelli G, Prete M, Favoino E, Ferrone S, Dammacco F. Beta 2-microglobulin-free HLA class I heavy chain epitope mimicry by monoclonal antibody HC-10-specific peptide. J Immunol. 2003;171(4):1918–26. Epub 2003/08/07. doi: 10.4049/jimmunol.171.4.1918 12902494.
38. Beutler N, Hauka S, Niepel A, Kowalewski DJ, Uhlmann J, Ghanem E, et al. A natural tapasin isoform lacking exon 3 modifies peptide loading complex function. Eur J Immunol. 2013;43(6):1459–69. Epub 2013/03/23. doi: 10.1002/eji.201242725 23519916.
39. Wearsch PA, Cresswell P. Selective loading of high-affinity peptides onto major histocompatibility complex class I molecules by the tapasin-ERp57 heterodimer. Nature immunology. 2007;8(8):873–81. Epub 2007/07/03. doi: 10.1038/ni1485 17603487.
40. Chen M, Bouvier M. Analysis of interactions in a tapasin/class I complex provides a mechanism for peptide selection. The EMBO journal. 2007;26(6):1681–90. Epub 2007/03/03. doi: 10.1038/sj.emboj.7601624 17332746; PubMed Central PMCID: PMC1829385.
41. Williams AP, Peh CA, Purcell AW, McCluskey J, Elliott T. Optimization of the MHC class I peptide cargo is dependent on tapasin. Immunity. 2002;16(4):509–20. Epub 2002/04/24. 11970875.
42. Ahn K, Angulo A, Ghazal P, Peterson PA, Yang Y, Fruh K. Human cytomegalovirus inhibits antigen presentation by a sequential multistep process. Proceedings of the National Academy of Sciences of the United States of America. 1996;93(20):10990–5. Epub 1996/10/01. doi: 10.1073/pnas.93.20.10990 8855296; PubMed Central PMCID: PMC38271.
43. Kowalewski DJ, Stevanovic S. Biochemical large-scale identification of MHC class I ligands. Methods Mol Biol. 2013;960 : 145–57. Epub 2013/01/19. doi: 10.1007/978-1-62703-218-6_12 23329485.
44. Nielsen M, Lundegaard C, Worning P, Lauemoller SL, Lamberth K, Buus S, et al. Reliable prediction of T-cell epitopes using neural networks with novel sequence representations. Protein science: a publication of the Protein Society. 2003;12(5):1007–17. Epub 2003/04/30. doi: 10.1110/ps.0239403 12717023; PubMed Central PMCID: PMC2323871.
45. Vogel R, Al-Daccak R, Drews O, Alonzeau J, Mester G, Charron D, et al. Mass spectrometry reveals changes in MHC I antigen presentation after lentivector expression of a gene regulation system. Molecular therapy Nucleic acids. 2013;2:e75. Epub 2013/02/14. doi: 10.1038/mtna.2013.3 23403517; PubMed Central PMCID: PMC3586803.
46. Macdonald WA, Purcell AW, Mifsud NA, Ely LK, Williams DS, Chang L, et al. A naturally selected dimorphism within the HLA-B44 supertype alters class I structure, peptide repertoire, and T cell recognition. The Journal of experimental medicine. 2003;198(5):679–91. doi: 10.1084/jem.20030066 12939341; PubMed Central PMCID: PMC2194191.
47. Stern-Ginossar N, Weisburd B, Michalski A, Le VT, Hein MY, Huang SX, et al. Decoding human cytomegalovirus. Science. 2012;338(6110):1088–93. Epub 2012/11/28. doi: 10.1126/science.1227919 23180859.
48. Brodin P, Jojic V, Gao T, Bhattacharya S, Angel CJ, Furman D, et al. Variation in the human immune system is largely driven by non-heritable influences. Cell. 2015;160(1–2):37–47. Epub 2015/01/17. doi: 10.1016/j.cell.2014.12.020 25594173; PubMed Central PMCID: PMC4302727.
49. Romania P, Cifaldi L, Pignoloni B, Starc N, D'Alicandro V, Melaiu O, et al. Identification of a Genetic Variation in ERAP1 Aminopeptidase that Prevents Human Cytomegalovirus miR-UL112-5p-Mediated Immunoevasion. Cell reports. 2017;20(4):846–53. Epub 2017/07/27. doi: 10.1016/j.celrep.2017.06.084 28746870.
50. Furman MH, Dey N, Tortorella D, Ploegh HL. The human cytomegalovirus US10 gene product delays trafficking of major histocompatibility complex class I molecules. Journal of virology. 2002;76(22):11753–6. Epub 2002/10/22. doi: 10.1128/JVI.76.22.11753-11756.2002 12388737; PubMed Central PMCID: PMC136774.
51. Tirabassi RS, Ploegh HL. The human cytomegalovirus US8 glycoprotein binds to major histocompatibility complex class I products. Journal of virology. 2002;76(13):6832–5. Epub 2002/06/07. 12doi: 10.1128/JVI.76.13.6832-6835.2002 1205039650396; PubMed Central PMCID: PMC136258.
52. Trgovcich J, Cebulla C, Zimmerman P, Sedmak DD. Human cytomegalovirus protein pp71 disrupts major histocompatibility complex class I cell surface expression. Journal of virology. 2006;80(2):951–63. Epub 2005/12/28. doi: 10.1128/JVI.80.2.951-963.2006 16378997; PubMed Central PMCID: PMC1346885.
53. Erhard F, Halenius A, Zimmermann C, L'Hernault A, Kowalewski DJ, Weekes MP, et al. Improved Ribo-seq enables identification of cryptic translation events. Nature methods. 2018;15(5):363–6. Epub 2018/03/13. doi: 10.1038/nmeth.4631 29529017.
54. Ameres S, Besold K, Plachter B, Moosmann A. CD8 T cell-evasive functions of human cytomegalovirus display pervasive MHC allele specificity, complementarity, and cooperativity. J Immunol. 2014;192(12):5894–905. Epub 2014/05/09. doi: 10.4049/jimmunol.1302281 24808364.
55. Besold K, Wills M, Plachter B. Immune evasion proteins gpUS2 and gpUS11 of human cytomegalovirus incompletely protect infected cells from CD8 T cell recognition. Virology. 2009;391(1):5–19. Epub 2009/07/03. doi: 10.1016/j.virol.2009.06.004 19570562.
56. Rajapaksa US, Li D, Peng YC, McMichael AJ, Dong T, Xu XN. HLA-B may be more protective against HIV-1 than HLA-A because it resists negative regulatory factor (Nef) mediated down-regulation. Proceedings of the National Academy of Sciences of the United States of America. 2012;109(33):13353–8. doi: 10.1073/pnas.1204199109 22826228; PubMed Central PMCID: PMC3421200.
57. Rado-Trilla N, Alba M. Dissecting the role of low-complexity regions in the evolution of vertebrate proteins. BMC evolutionary biology. 2012;12 : 155. Epub 2012/08/28. doi: 10.1186/1471-2148-12-155 22920595; PubMed Central PMCID: PMC3523016.
58. Parham P, Barnstable CJ, Bodmer WF. Use of a monoclonal antibody (W6/32) in structural studies of HLA-A,B,C, antigens. J Immunol. 1979;123(1):342–9. Epub 1979/07/01. 87477.
59. Sadasivan B, Lehner PJ, Ortmann B, Spies T, Cresswell P. Roles for calreticulin and a novel glycoprotein, tapasin, in the interaction of MHC class I molecules with TAP. Immunity. 1996;5(2):103–14. Epub 1996/08/01. 8769474.
60. Barel MT, Hassink GC, van Voorden S, Wiertz EJ. Human cytomegalovirus-encoded US2 and US11 target unassembled MHC class I heavy chains for degradation. Molecular immunology. 2006;43(8):1258–66. Epub 2005/08/16. doi: 10.1016/j.molimm.2005.07.005 16098592.
61. Li L, Santarsiero BD, Bouvier M. Structure of the Adenovirus Type 4 (Species E) E3-19K/HLA-A2 Complex Reveals Species-Specific Features in MHC Class I Recognition. J Immunol. 2016;197(4):1399–407. Epub 2016/07/08. doi: 10.4049/jimmunol.1600541 27385781; PubMed Central PMCID: PMC4975982.
62. Nitschke K, Luxenburger H, Kiraithe MM, Thimme R, Neumann-Haefelin C. CD8+ T-Cell Responses in Hepatitis B and C: The (HLA-) A, B, and C of Hepatitis B and C. Dig Dis. 2016;34(4):396–409. doi: 10.1159/000444555 27170395.
63. Goulder PJ, Walker BD. HIV and HLA class I: an evolving relationship. Immunity. 2012;37(3):426–40. doi: 10.1016/j.immuni.2012.09.005 22999948; PubMed Central PMCID: PMC3966573.
64. Hertz T, Nolan D, James I, John M, Gaudieri S, Phillips E, et al. Mapping the landscape of host-pathogen coevolution: HLA class I binding and its relationship with evolutionary conservation in human and viral proteins. Journal of virology. 2011;85(3):1310–21. doi: 10.1128/JVI.01966-10 21084470; PubMed Central PMCID: PMC3020499.
65. Gumperz JE, Litwin V, Phillips JH, Lanier LL, Parham P. The Bw4 public epitope of HLA-B molecules confers reactivity with natural killer cell clones that express NKB1, a putative HLA receptor. The Journal of experimental medicine. 1995;181(3):1133–44. doi: 10.1084/jem.181.3.1133 7532677; PubMed Central PMCID: PMC2191933.
66. Busche A, Jirmo AC, Welten SP, Zischke J, Noack J, Constabel H, et al. Priming of CD8+ T cells against cytomegalovirus-encoded antigens is dominated by cross-presentation. J Immunol. 2013;190(6):2767–77. doi: 10.4049/jimmunol.1200966 23390296.
67. Seckert CK, Schader SI, Ebert S, Thomas D, Freitag K, Renzaho A, et al. Antigen-presenting cells of haematopoietic origin prime cytomegalovirus-specific CD8 T-cells but are not sufficient for driving memory inflation during viral latency. The Journal of general virology. 2011;92(Pt 9):1994–2005. doi: 10.1099/vir.0.031815-0 21632567.
68. Matschulla T, Berry R, Gerke C, Döring M, Busch J, Paijo J, et al. A highly conserved sequence of the viral TAP inhibitor ICP47 is required for freezing of the peptide transport cycle. Scientific reports. 2017;7(1):2933. doi: 10.1038/s41598-017-02994-5 28592828
69. D'Urso CM, Wang ZG, Cao Y, Tatake R, Zeff RA, Ferrone S. Lack of HLA class I antigen expression by cultured melanoma cells FO-1 due to a defect in B2m gene expression. The Journal of clinical investigation. 1991;87(1):284–92. Epub 1991/01/01. doi: 10.1172/JCI114984 1898655; PubMed Central PMCID: PMC295046.
70. Wagner M, Ruzsics Z, Koszinowski UH. Herpesvirus genetics has come of age. Trends in microbiology. 2002;10(7):318–24. Epub 2002/07/12. 12110210.
71. Le VT, Trilling M, Hengel H. The cytomegaloviral protein pUL138 acts as potentiator of tumor necrosis factor (TNF) receptor 1 surface density to enhance ULb'-encoded modulation of TNF-alpha signaling. Journal of virology. 2011;85(24):13260–70. Epub 2011/10/07. doi: 10.1128/JVI.06005-11 21976655; PubMed Central PMCID: PMC3233134.
72. Atalay R, Zimmermann A, Wagner M, Borst E, Benz C, Messerle M, et al. Identification and expression of human cytomegalovirus transcription units coding for two distinct Fcgamma receptor homologs. Journal of virology. 2002;76(17):8596–608. Epub 2002/08/07. doi: 10.1128/JVI.76.17.8596-8608.2002 12163579; PubMed Central PMCID: PMC136976.
73. Sinzger C, Hahn G, Digel M, Katona R, Sampaio KL, Messerle M, et al. Cloning and sequencing of a highly productive, endotheliotropic virus strain derived from human cytomegalovirus TB40/E. The Journal of general virology. 2008;89(Pt 2):359–68. doi: 10.1099/vir.0.83286–0 18198366.
74. Brodsky FM, Parham P, Barnstable CJ, Crumpton MJ, Bodmer WF. Monoclonal antibodies for analysis of the HLA system. Immunological reviews. 1979;47 : 3–61. Epub 1979/01/01. doi: 10.1111/j.1600-065x.1979.tb00288.x 95015.
75. Tahara T, Yang SY, Khan R, Abish S, Hammerling GJ, Hammerling U. HLA antibody responses in HLA class I transgenic mice. Immunogenetics. 1990;32(5):351–60. Epub 1990/01/01. doi: 10.1007/bf00211650 2249882.
76. Stam NJ, Vroom TM, Peters PJ, Pastoors EB, Ploegh HL. HLA-A - and HLA-B-specific monoclonal antibodies reactive with free heavy chains in western blots, in formalin-fixed, paraffin-embedded tissue sections and in cryo-immuno-electron microscopy. International immunology. 1990;2(2):113–25. Epub 1990/01/01. doi: 10.1093/intimm/2.2.113 2088481.
77. Kowalewski DJ, Schuster H, Backert L, Berlin C, Kahn S, Kanz L, et al. HLA ligandome analysis identifies the underlying specificities of spontaneous antileukemia immune responses in chronic lymphocytic leukemia (CLL). Proceedings of the National Academy of Sciences of the United States of America. 2015;112(2):E166–75. Epub 2014/12/31. doi: 10.1073/pnas.1416389112 25548167; PubMed Central PMCID: PMC4299203.
78. Kall L, Canterbury JD, Weston J, Noble WS, MacCoss MJ. Semi-supervised learning for peptide identification from shotgun proteomics datasets. Nature methods. 2007;4(11):923–5. Epub 2007/10/24. doi: 10.1038/nmeth1113 17952086.
79. Gonen-Gross T, Achdout H, Arnon TI, Gazit R, Stern N, Horejsi V, et al. The CD85J/leukocyte inhibitory receptor-1 distinguishes between conformed and beta 2-microglobulin-free HLA-G molecules. J Immunol. 2005;175(8):4866–74. doi: 10.4049/jimmunol.175.8.4866 16210588.
80. Crooks GE, Hon G, Chandonia JM, Brenner SE. WebLogo: a sequence logo generator. Genome Res. 2004;14(6):1188–90. doi: 10.1101/gr.849004 15173120; PubMed Central PMCID: PMC419797.
81. Bardou P, Mariette J, Escudie F, Djemiel C, Klopp C. jvenn: an interactive Venn diagram viewer. BMC Bioinformatics. 2014;15 : 293. doi: 10.1186/1471-2105-15-293 25176396; PubMed Central PMCID: PMC4261873.
Štítky
Hygiena a epidemiológia Infekčné lekárstvo Laboratórium
Článok vyšiel v časopisePLOS Pathogens
Najčítanejšie tento týždeň
2019 Číslo 9- Parazitičtí červi v terapii Crohnovy choroby a dalších zánětlivých autoimunitních onemocnění
- Očkování proti virové hemoragické horečce Ebola experimentální vakcínou rVSVDG-ZEBOV-GP
- Koronavirus hýbe světem: Víte jak se chránit a jak postupovat v případě podezření?
-
Všetky články tohto čísla
- Conidial surface proteins at the interface of fungal infections
- Is reliance on an inaccurate genome sequence sabotaging your experiments?
- The molecular clock of Mycobacterium tuberculosis
- The opportunistic pathogen Stenotrophomonas maltophilia utilizes a type IV secretion system for interbacterial killing
- The ClpX chaperone controls autolytic splitting of Staphylococcus aureus daughter cells, but is bypassed by β-lactam antibiotics or inhibitors of WTA biosynthesis
- The phage gene wmk is a candidate for male killing by a bacterial endosymbiont
- Anti-HIV potency of T-cell responses elicited by dendritic cell therapeutic vaccination
- Mucosal CD8+ T cell responses induced by an MCMV based vaccine vector confer protection against influenza challenge
- Epstein-Barr virus subverts mevalonate and fatty acid pathways to promote infected B-cell proliferation and survival
- RACK1 mediates rewiring of intracellular networks induced by hepatitis C virus infection
- Neutralization-guided design of HIV-1 envelope trimers with high affinity for the unmutated common ancester of CH235 lineage CD4bs broadly neutralizing antibodies
- HLA-B locus products resist degradation by the human cytomegalovirus immunoevasin US11
- A robust human norovirus replication model in zebrafish larvae
- Humoral immunity prevents clinical malaria during Plasmodium relapses without eliminating gametocytes
- Tuberculosis drug discovery in the CRISPR era
- Correction: Cryptococcus neoformans resists to drastic conditions by switching to viable but non-culturable cell phenotype
- Molecular basis of dengue virus serotype 2 morphological switch from 29°C to 37°C
- Emergomyces: The global rise of new dimorphic fungal pathogens
- Avian oncogenic herpesvirus antagonizes the cGAS-STING DNA-sensing pathway to mediate immune evasion
- A fungal ABC transporter FgAtm1 regulates iron homeostasis via the transcription factor cascade FgAreA-HapX
- Cytolethal distending toxin induces the formation of transient messenger-rich ribonucleoprotein nuclear invaginations in surviving cells
- The fitness landscape of the African Salmonella Typhimurium ST313 strain D23580 reveals unique properties of the pBT1 plasmid
- Vaccine protection against rectal acquisition of SIVmac239 in rhesus macaques
- Deciphering the interplay between the genotoxic and probiotic activities of Escherichia coli Nissle 1917
- Phytoplasma SAP11 effector destabilization of TCP transcription factors differentially impact development and defence of Arabidopsis versus maize
- Emodepside has sex-dependent immobilizing effects on adult Brugia malayi due to a differentially spliced binding pocket in the RCK1 region of the SLO-1 K channel
- Immunization with a murine cytomegalovirus based vector encoding retrovirus envelope confers strong protection from Friend retrovirus challenge infection
- Persistent Crimean-Congo hemorrhagic fever virus infection in the testes and within granulomas of non-human primates with latent tuberculosis
- An essential thioredoxin-type protein of Trypanosoma brucei acts as redox-regulated mitochondrial chaperone
- Long-term surviving influenza infected cells evade CD8+ T cell mediated clearance
- Pyruvate produced by Brugia spp. via glycolysis is essential for maintaining the mutualistic association between the parasite and its endosymbiont, Wolbachia
- PLOS Pathogens
- Archív čísel
- Aktuálne číslo
- Informácie o časopise
Najčítanejšie v tomto čísle- Mucosal CD8+ T cell responses induced by an MCMV based vaccine vector confer protection against influenza challenge
- Neutralization-guided design of HIV-1 envelope trimers with high affinity for the unmutated common ancester of CH235 lineage CD4bs broadly neutralizing antibodies
- Anti-HIV potency of T-cell responses elicited by dendritic cell therapeutic vaccination
- Phytoplasma SAP11 effector destabilization of TCP transcription factors differentially impact development and defence of Arabidopsis versus maize
Prihlásenie#ADS_BOTTOM_SCRIPTS#Zabudnuté hesloZadajte e-mailovú adresu, s ktorou ste vytvárali účet. Budú Vám na ňu zasielané informácie k nastaveniu nového hesla.
- Časopisy