A role of hypoxia-inducible factor 1 alpha in Mouse Gammaherpesvirus 68 (MHV68) lytic replication and reactivation from latency
Authors:
Darlah M. López-Rodríguez aff001; Varvara Kirillov aff003; Laurie T. Krug aff003; Enrique A. Mesri aff001; Samita Andreansky aff001
Authors place of work:
Department of Microbiology and Immunology and Miami Center for AIDS Research, Miami, Florida, United States of America
aff001; Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, Florida, United States of America
aff002; Department of Molecular Genetics and Microbiology, Stony Brook University, Stony Brook, New York, United States of America
aff003; Department of Pediatrics, University of Miami Miller School of Medicine, Miami, Florida
aff004
Published in the journal:
A role of hypoxia-inducible factor 1 alpha in Mouse Gammaherpesvirus 68 (MHV68) lytic replication and reactivation from latency. PLoS Pathog 15(12): e1008192. doi:10.1371/journal.ppat.1008192
Category:
Research Article
doi:
https://doi.org/10.1371/journal.ppat.1008192
Summary
The hypoxia-inducible factor 1 alpha (HIF1α) protein and the hypoxic microenvironment are critical for infection and pathogenesis by the oncogenic gammaherpesviruses (γHV), Kaposi’ Sarcoma-associated Herpes Virus (KSHV) and Epstein-Barr virus (EBV). However, understanding the role of HIF1α during the virus life cycle and its biological relevance in the context of host pathogenesis has been challenging due to the lack of animal models for human γHV. To study the role of HIF1α, we employed the murine gammaherpesvirus 68 (MHV68), a rodent pathogen that readily infects laboratory mice. We show that MHV68 infection induces HIF1α protein and HIF1α-responsive gene expression in permissive cells. siRNA silencing or drug-inhibition of HIF1α reduce virus production due to a global downregulation of viral gene expression. Most notable was the marked decrease in many viral genes bearing hypoxia-responsive elements (HREs) such as the viral G-Protein Coupled Receptor (vGPCR), which is known to activate HIF1α transcriptional activity during KSHV infection. We found that the promoter of MHV68 ORF74 is responsive to HIF1α and MHV-68 RTA. Moreover, Intranasal infection of HIF1αLoxP/LoxP mice with MHV68 expressing Cre - recombinase impaired virus expansion during early acute infection and affected lytic reactivation in the splenocytes explanted from mice. Low oxygen concentrations accelerated lytic reactivation and enhanced virus production in MHV68 infected splenocytes. Thus, we conclude that HIF1α plays a critical role in promoting virus replication and reactivation from latency by impacting viral gene expression. Our results highlight the importance of the mutual interactions of the oxygen-sensing machinery and gammaherpesviruses in viral replication and pathogenesis.
Keywords:
Herpesviruses – Viral replication – Mouse models – Hypoxia – Oxygen – Viral persistence and latency – Kaposi's sarcoma-associated herpesvirus – K cells
Introduction
Many pathogenic viruses need to adapt to different physiological oxygen levels for efficient infection of the host by controlling the host’s oxygen-sensing transcriptional machinery centered around the regulation of the hypoxia-inducible factors, the main transcriptional regulators of the hypoxia-stimulated genes. Hypoxia Inducible Factor 1 alpha (HIF1α) is a eukaryotic cellular transcription factor whose main role is to support the adaptation of cells and tissues to lower oxygen concentrations. Hypoxic cells react by upregulating genes to enable oxygen delivery, increase glucose uptake, and anaerobic metabolism to facilitate survival of cells and tissues [1,2]. Oxygen levels within the cell tightly regulate HIF1α. In the presence of oxygen, HIF1α is rapidly targeted for degradation by the ubiquitin complex via proline hydroxylation [2]. When oxygen demand exceeds oxygen supply, HIF1α protein is no longer degraded and is translocated to the nucleus. Here, HIF1α binds the constitutively expressed HIF1β forming a heterodimeric helix-loop-helix transcriptional complex. The HIF1 heterodimer recognizes the DNA-binding motif known as the hypoxia-response element (HRE) within the promoter of target genes. This leads to the expression of proteins such as vascular endothelial growth factors, glucose transporters, and erythropoietin required to adapt to low oxygen levels [3].
Activation of HIF1α protein has been observed during virus infection, leading to metabolic adaptation and allowing viral replication. Several viruses such as Epstein Barr Virus (EBV) [4], Human Cytomegalovirus [5], Respiratory Syncytial Virus (RSV) [6], Varicella Zoster Virus (VZV) [7], John Cunningham Virus (JCV) [8] and Influenza A [9] are now known to upregulate HIF1α under normoxia. Notably, the oncogenic human gammaherpesviruses such as Kaposi sarcoma-associated Herpes Virus (KSHV) and Epstein Barr Virus (EBV) have evolved to exploit this component of the oxygen-sensing machinery for their survival and persistence in the host [10–15]. Kaposi’ Sarcoma (KS), an angiogenic spindle-cell sarcoma caused by KSHV, predominantly develops in lower extremities, which have relatively low oxygen concentration [16–19]. KSHV infection and specific viral products increase the levels of HIF1α and its transcriptional activity, allowing a viral-driven regulation of host processes critical for angiogenesis and glycolysis, which benefits viral replication along with HIF1α-driven viral gene regulation. [20–25]. During latency, KSHV infection imparts a hypoxic signature to infected cells [26]. In vitro experiments have demonstrated that HIF1α plays an important role in lytic reactivation of KSHV and EBV from latently infected cell lines by binding to the promoter of the immediate early viral genes Replication and Transcription Activator (RTA) in KSHV and Zp in EBV [13,14,27,28]. Also, the Latency-Associated Nuclear Antigen (LANA), a key viral protein, enhances HIF1α transcription and cooperates with RTA to promote lytic replication [8]. Similarly, exposure of latently infected mouse B-cell lymphomas with mouse gammaherpesvirus 68 to hypoxia conditions and HIF1α expression increased transcription activity of RTA [29].
Infection with herpesviruses leads to lytic replication followed by latency establishment in the host. Viral latency in infected cells sustains the persistence of the virus during its lifetime, while lytic replication from latently infected cells permits the spread of the virus. Given the host-specific nature of human gammaherpesviruses, the role of HIF1α in pathogenesis is difficult to elucidate as they exhibit limited lytic replication in vitro, and there is no established small animal model of infection [30]. Opportunely, Murine gammaherpesvirus 68 (MHV68) undergoes lytic replication upon de novo infection in permissive cells and readily infects laboratory mice. MHV68 is genetically related to KSHV and encodes many homologous genes of KSHV that are required for both lytic and latent stages of the virus life cycle [31]. Thus, our objective was to elucidate the role of HIF1α during host infection by MHV68 and its virus life cycle using both in vitro and in vivo infection models.
We report that MHV68 infection of permissive cells upregulated HIF1α transcription and led to the upregulation of its protein levels. Genetic ablation of HIF1α transcription activity decreased the production of virus and expression of several HRE-containing viral genes. Ablation of HIF1α transcription activity in vivo by intranasal infection of HIF1αLoxP/LoxP mice with an MHV68 virus expressing Cre-recombinase impaired virus expansion in lungs and affected reactivation after latency establishment. These findings establish the role of HIF1α during gammaherpesvirus pathogenesis in an inherent host.
Results
MHV68 infection upregulates HIF1α expression and transcriptional activity
We first determined whether MHV68 upregulates HIF1α during virus infection in culture. The mouse fibroblast cell line NIH 3T12 was infected with a wild type MHV68 strain in normoxia (21% O2), HIF1α mRNA and protein levels were analyzed by qRT-PCR and western blot, respectively. Fig 1 shows the upregulation of HIF1α protein at early time-points during MHV68 infection, which increases over time. Cobalt chloride (CoCl2), a hypoxia mimic, was used as a positive control [32]. Upregulation of HIF1α protein levels correlated to a 6-fold increase in HIF1α mRNA levels (Fig 1B) at 24 hpi when compared to uninfected cells indicating that induction of HIF1α activity by MHV68 occurs together with activation of transcription. Moreover, transcription of HIF1α was dependent on viral gene expression, as we did not detect HIF1α mRNA upregulation when cells were exposed to UV-inactivated virus (Fig 1B). We next sought to determine whether upregulation of HIF1α during MHV68 infection activates HIF1α mediated transcription of host HIF1-regulated genes, which containing HRE-binding sites at the regulatory region using an HRE-dependent luciferase reporter in a dual-luciferase assay. 3T12 cells were transfected with the reporter and then infected under normoxia (21% O2) and hypoxia (1%O2) at different MOI. We found an increase in firefly luciferase reporter activity 24 hpi in cells infected with MHV68 in comparison to uninfected controls (Fig 1C-left), which was higher in hypoxia than normoxia suggesting that both infection and hypoxic conditions contribute to the enhancement of HIF1α transcription activity. Substitution of HRE consensus nucleotides ablated luciferase response under MHV68 infection, indicating HRE-dependent specific activation (Fig 1C-right). Upregulation of HIF1α by oncogenic gammaherpesviruses is central to the induction of metabolic reprogramming, which occurs via the upregulation of HIF1α regulated genes such as glucose transporter 1 (GLUT-1), glucose-6 phosphate isomerase (GPI) and pyruvate kinase (PKM). These are key enzymes required for energy production during cellular adaptation to episodes of low oxygen. We, therefore, determined if HIF upregulation by MHV68 lead to an increase in transcription of these metabolic HIF-target genes using qRT-PCR. Transcription of genes was increased 7 to 5-fold in MHV68 infected cells (Fig 1D) and was dependent on virus infection as cells exposed to UV-irradiated virus failed to induce upregulation of HIF1α-regulated genes. Taken together, the data depicted in Fig 1 shows that MHV68 infection upregulates HIF1α levels and transcriptional activity.
Genetic Ablation of HIF1α DNA binding domain suppresses HRE-dependent transcription
The upregulation of HIF1α protein during MHV68 infection indicates that this transcription factor plays a role during virus replication. We, therefore, sought to evaluate the impact of HIF1α on lytic replication and viral expression in knock-out cells. We obtained primary MEFs from transgenic knock-in mouse (B6.129-Hif1αtm3Rsjo/J), with exon 2 of the HIF1α gene flanked by 34bp specific LoxP sites (HIF1αLoxP MEFs) [33]. Exon 2 encodes the DNA-binding region required for the dimerization of the protein in the nucleus and transcription of HIF1 target genes. A cre-recombinase expressing lentivirus was employed to transduce HIF1αLoxP MEFs followed by selection for resistance to the antibiotic Blasticidin. We first characterized both HIF1α wild-type (WT = MEFs from HIF1αLoxP transgenic mice) and HIF1α Null cells (Null = HIF1αLoxP MEFs expressing Cre-recombinase) by performing mRNA analysis with specific HIF1α oligonucleotides for HIF1α cDNA. Exon 2 deletion was detected as a fragment size shift to 400bp in HIFα Null cells in contrast to the complete 600bp PCR product spanning exon 1 to exon 5 in non-transduced HIF1αLoxP MEFs (S1A Fig). Also, no amplification of exon 2 was detected by qPCR in Null cells when compared to WT MEFs, and no change of expression was observed in Exon 4/5 transcripts (S1B Fig).
Null cells were further analyzed to confirm that they lacked HIF1α transcriptional activity using an HRE-luc reporter and qRT-PCR for HIF1α-regulated genes, as done in S1C and S1D Fig. Luciferase signal was 10-fold less in Null cells following 8-hour treatment with the hypoxia mimic CoCl2, indicating HIF1α dependent activity was impaired. Also, transcription of HIF1α-regulated glycolytic genes was verified by qRT-PCR in Null cells. Each HIF1α transcript exhibited a significant decrease in expression after 8-hour treatment in 1% O2 conditions, confirming that HIF1α protein was inactive in Null cells.
Absence of HIF1α activity impairs MHV68 replication in vitro
Next, we assessed whether the absence of HIF1α transcription activity could affect virus lytic replication. HIF1α wild-type (WT) and Null MEFs were infected with high and low MOI of MHV68 virus, viral supernatants were harvested at different times post-infection (dpi), and amount of infectious virus was determined by plaque assay. Fig 2A shows HIF1α protein expression is downregulated in Null MEFs at 24 hours of infection. Comparing virus titers in WT and Null cells inoculated with varying MOI, virus production was decreased uniformly in the absence of HIF1α. As shown in Fig 2B, time-course infection of Null cells at 5.0 MOI showed a slight reduction while a lower infection of 0.5 MOI had a significant decreased in virus production at later time-points. These results suggest a role for HIF1α during lytic replication. Thus HIF1α is necessary for the efficient production of infectious particles during MHV68 replication.
Absence of HIF1α impairs viral gene expression in MHV68
The murine gammaherpesvirus shares significant homology with human gammaherpesviruses such as KSHV and EBV and encodes for several viral orthologs. HIF1α transcriptionally upregulates KSHV genes containing the HRE consensus sites (5’-ACGTG-3’) in hypoxia [34], and HIF1α regulates viral persistence by binding HRE homologs located throughout the genome [27]. Thus, we analyzed MHV68 viral promoters containing the consensus HIF1α binding motif with the Biobase TRANSFAC database. The transcription element search system was employed to identify potential transcription binding sites containing the string site RCGTG within 500 base pairs upstream of the starting codon of all the MHV68 open reading frames. The results, depicted as a diagram in Fig 2C, predicted 17 viral promoters with HREs in all classes of MHV68 genes (immediate-early, early and late), including the KSHV orthologs of open reading frames (ORFs) 43, 44, 50 (RTA), 73 (LANA) and 74 (vGPCR) which belong to the hypoxia-responsive KSHV clusters [27].
A qRT-PCR was performed in infected WT and HIF1α Null cells to measure mRNA levels of these 17 MHV68-HRE containing and non-containing ORFs. Viral mRNA was harvested from infected cell lysates 24 hpi since cytolysis is low, and virus production is present. The absence of HIF1α activity decreased transcription of many HRE containing viral genes in Null cells when compared to the transcript levels of WT MEFs (Fig 2D and S1 Table). Within the HRE-containing viral genes, the most notable downregulation was observed for the viral G protein-coupled receptor (vGPCR/ORF74), a KSHV viral gene known to regulate HIF1α transcriptional activity and angiogenesis in KS [23–25]. Also, viral cyclin D homolog (ORF72), and ORF73, latency-associated nuclear antigen (LANA) were reduced 3-fold Several HRE - containing viral genes designated for viral replication such as ORF44, a component of DNA helicase-primase complex and ORF65, a DNA packaging protein was downregulated 2-fold and was statistically significant. Taken together, our results indicate that HIF1α may directly or indirectly regulate expression of HREs-containing viral genes required for optimal growth kinetics during MHV68 replication.
HIF1α activity is required to induce host genes during MHV68 replication
MHV68 infection of 3T12 cells increased transcription of glycolytic genes (Fig 1D). This data is in line with the observation that herpes virus infections induce glycolysis through the anabolic pathway in order to support increased demand on cellular translation machinery required during viral replication and also to maintain latently infected cells [35].
We undertook the analysis of genes involved in glucose uptake after virus infection in WT and Null cells. UV-irradiated virus and mock-infected MEFs were used for negative controls. Lytic infection upregulated up to 5–10 folds several enzymes such as glucose transporter 1 (GLT1) which is involved in glucose uptake [36], glucose-6 phosphate isomerase (GPI), which is the first enzyme in glycolytic pathway, and pyruvate kinase (PKM), which catalyzes the final step of glycolysis (Fig 2E). The increase in gene expression in WT MEFs was dependent on replication of the virus as the UV-inactivated virus did not induce aerobic glycolysis or HIF1α in WT MEFs. In contrast, glycolytic gene expression was consistently similar to uninfected in Null cells. (Fig 2E), suggesting that the transcriptional activity of HIF1α is required for the induction of glycolytic enzymes during MHV68 lytic replication.
The vGPCR (mORF74) viral promoter of MHV68 contains hypoxia-responsive elements and is transcriptionally activated by HIF1α expression
Downregulation of ORF74 mRNA in HIF1α Null cells (Fig 2D) and the presence of HREs consensus (Fig 2F, ACGTG, AGGTG, GCGT) within this promoter point to a role for HIF1α in transcriptional regulation of the viral gene. In order to determine HIF1α dependent transcription activation, the promoter region spanning nucleotides at -597 to start codon of ORF74 was inserted upstream of the luciferase reporter pGL2-Basic vector. MHV68 ORF74 promoter luciferase construct was transiently transfected into 293AD cells with increasing amounts of an oxygen-degradation insensitive HIF1α mutant. Fig 2G (top) shows statistically significant 2.6-fold activation to mock transfection. Moreover, the addition of expression vector containing full-length MHV68 RTA (mORF50) further enhances promoter activity (2-fold) in the presence of constitutively active HIF1α (Fig 2G - bottom). These findings suggest a role for transcription regulation of MHV68 ORF74 by HIF1α, as previously observed in KSHV vGPCR [37].
siRNA silencing and drug-mediated inhibition of HIF1α impairs MHV68 replication
In order to rule out any confounding effects due to the long-term impact of HIF1α exon 2 deletion in Null cells, we carried out two alternative approaches to inhibit HIF1 activity during MHV68 lytic infection. First, 3T12 cells were transfected with a HIF1α siRNA for 24 hours, followed by infection in normoxic conditions. The top panel of Fig 3A confirms HIF1α protein expression is abolished in HIF1α siRNA cells of uninfected and MHV68 infected cells cultured at 3% O2. Silencing of HIF1α during normoxic infection significantly reduces viral titers by 20-fold at 48hpi, on average, and drastically downregulates the expression of lytic replication genes (Fig 3A - 2nd row). In the second approach (Fig 3B), we utilized PX478, a small molecule inhibitor that has been shown to potently inhibit HIF1α transcription activity [38], in addition to reducing HIF1α protein and mRNA synthesis [12]. In the first row of Fig 3B, we show 3T12 cells exposed to 25μM of PX478 decrease in HIF1α expression 24hpi, even HIF1α-induced conditions. After MHV68 incubation, infected 3T12 cells were treated with 15, 20, and 25μM of PX478 and cultured at 21% O2. At 48 hours, viral titers in supernatants from 25μM PX478 were 10-fold less than titers from untreated supernatants. Moreover, the extent of the downregulation of lytic genes, 24 hours prior, was parallel with the increment in PX478 concentration (Fig 3B - 2nd row). Finally, blocking HIF1α activity through these approaches also impaired MHV68-induced expression of glycolytic genes (Fig 3 - 3rd row). These data confirm our observations, pointing to a critical role for HIF1α in MHV68 lytic replication.
HIF1α is necessary for optimal MHV68 replication in lower, physiological, oxygen levels
Our data demonstrate that the absence of HIF1α affects viral gene expression and virion production during lytic replication in normoxia. However, oxygen levels may play a profound role during in vivo infection as tissues and organs are usually characterized by their unique oxygenation status. During low oxygen availability, HIF1α is stabilized and able to bind to promoter regions carrying specific HRE elements. Therefore, we speculated that lower oxygen levels, along with the effects in lack of HIF1α, would be more profound.
We performed a western blot analysis to determine the expression of HIF1α protein after virus infection in 3% O2 conditions hypoxia since physiological levels of oxygen in many tissues ranges, 3–7% [39]. 3T12 cells were infected with wild type, MHV68 in normoxia for 2 hours, and then moved to a hypoxia chamber. Cell lysates were harvested 4-24hpi, and HIF1α expression was analyzed by western blot analysis. In Fig 4A (top), we show that infection at low levels of O2 up-regulates HIF1α by 12hpi, sooner than normoxic infection (Fig 1A) and uninfected cells cultured at 3% O2 (Fig 4A-bottom).
The role of HIF1α on MHV68 replication at different oxygen levels was assessed in WT and Null MEFs infected with high and low MOI of the virus by quantifying virion production at various times. Fig 4B demonstrates that viral expansion in the absence of HIF1α decreases, especially as low MOI infection progresses under low oxygen tension with 2.3 and 4.5-fold change at 72 and 96 hpi, respectively.
To understand how oxygen level may affect the ability of HIF1α to regulate viral gene expression during virus infection, transcription analysis of HRE containing viral genes was performed 24 hpi as in Fig 4D. The data is represented by relative fold-change values, which were normalized against infected WT and Null MEFs under normoxic conditions (Fig 4D and S1 Table). The absence of HIF1α at low oxygen levels had a 10-fold reduction in expression of several HRE-containing genes such as cyclin D, LANA, and vGPCR. This decrease was most notable in some HRE containing viral genes, including vGPCR, which was reduced, on average, 34.6-fold in Null cells when compared to WT MEFs under 3% oxygen. Mainly, viral proteins related to viral and DNA replication (ORF9, RTA), assembly, and latency associated genes such as LANA (ORF73), cyclin D (ORF72), and M2 (S1 Table) were impacted by low oxygen level conditions in Null cells. Levels of mRNA expression of some MHV68 HRE-containing genes were modestly increased during wild-type infection at 3% O2 of HIF1α WT cells (S1 Table).
The role of HIF1α in MHV68 in vivo pathogenesis
Our data showed that HIF1α protein plays a significant role in the replication of MHV68. However, it is unknown the exact role that the HIF1α pathway plays in gammaherpesvirus pathogenesis. Since infection of mice with MHV68 provides a tractable animal model that manifests the fundamental strategies for gammaherpesvirus pathogenesis [31], we took advantage of genetic ablation of HIF1α in the HIF1αLoxP/LoxP mice by infection (Fig 5A) with a recombinant MHV68 virus encoding the Cre-recombinase protein under CMV promoter (MHV68-Cre) [40]. Homozygous deletion of HIF1α is lethal for development through embryogenesis [41], we utilized Cre-LoxP strategy to generate HIF1α deletion during MHV68-Cre infection. Several studies have reported the use of engineered MHV68 encoding Cre-recombinase gene to study virus-host interaction [42–44]. Our objective was to achieve the deletion of exon 2 in HIF1α locus in tissues by infection with an MHV68-Cre virus.
MHV68 undergoes a period of lytic replicative expansion in the respiratory tract and to a lesser extent in the spleen after intranasal infection of laboratory mice. Robust viral replication in the lungs is characterized by infectious virion production and is cleared within 10–15 dpi [31]. In order to define whether HIF1α plays a role during MHV68 infection, we examined virus replication in lungs and latent virus establishment and reactivation from splenocytes. C57BL/6 WT (wild-type) and HIF1αLoxP/LoxP mice were infected intranasally with 3 X 104 PFU of MHV68-Cre (Fig 5B) virus. The second set of experiments was performed in HIF1αLoxP/LoxP mice infected with MHV68-BAC (parental strain for the recombinant virus) to validate that transgenic mice equally support MHV68 replication (Fig 5B).
Lungs were harvested on days 3, 5, and 7 post-infection, and viral titers were measured from lung homogenates. MHV68-Cre virus established infection in both WT (1.3 X 104 PFU/ml ± 1.8 X 103) and HIF1αLoxP/LoxP mice (7.1 X 103 PFU/ml ± 2.4 X 103) by day 3 post-infection (Fig 5C). However, there was a 4-fold reduction of virus titer (2.2 X 104 PFU/ml ± 7 X 103) in HIF1αLoxP/LoxP mice on 5 dpi when compared virus titers in C57BL/6 WT (8.9 X 104 PFU/ml ± 1.9 X 104) mice. The decline in viral titers continued until day 7 post-infection with titer below the limit of detection for HIF1αLoxP infection when compared to 5.4 X 103 PFU/ml ± 1.6 X 103 virus in WT mice (Fig 5C). The decrease in acute viral replication was related specifically to the deletion of HIF1α activity, as viral kinetics and production were not affected in HIF1αLoxP/LoxP mice infected with MHV68-BAC (wild type) virus (Fig 5C). The mean PFU/ml was 1.5 X 104 PFU/ml ± 4.8 X 103 on 3 dpi, and 6.0 X 104 PFU/ml ± 8.2 X 103 on 5 dpi in these mice (Fig 5C) and was similar to viral titers observed in WT (C57Bl/6J) mice infected with MHV68-Cre virus.
Early innate immune responses to MHV68 infection is accompanied by inflammation [45–48]. Inflammatory cytokines involved in this process, include interleukin-1 beta (IL1β), and TNFα. Several cytokines such as IL1β, IFNβ, IL-6, TNFα, and IFNγ were analyzed from lung homogenates by ELISA from WT and HIF1αLoxP/LoxP mice infected with MHV68-Cre virus. Although there was a trend in the reduction of cytokine production in lungs from infected HIF1αLoxP/LoxP mice on day 7 when compared to C57Bl/6J mice, the levels were not statistically significant except for IL1β which was reduced 3.5-fold in floxed mice (Fig 5E). The reduction in IL1β levels on day 7 post-infection in the absence of HIF1α activity may be due to early viral clearance reflected titers on day 5. We conclude that inhibition of HIF1α activity during acute MHV68 infection impairs virus expansion in the initial days of infection.
Similar to human gammaherpesviruses, following virus clearance in the lungs, MHV68 establishes life-long latency in the host [49,50], and the spleen is the primary site of the latent reservoir. The establishment of latency is observed as early as day 16 post-infection, where a substantial number of splenocytes (mostly naïve B cells) can be reactivated to produce lytic virus when co-cultured in vitro with permissive cells [51,52].
Therefore, we determined whether HIF1α plays a role during viral latency establishment in vivo and reactivation ex vivo. C57BL/6 (WT) and HIF1αLoxP/LoxP mice were infected with MHV68-Cre virus, and splenocytes were harvested on days 16. The frequency of splenocytes harboring viral DNA (establishment) was determined by nested PCR. This assay has single-copy sensitivity for ORF50, which equates to one viral genome-positive cell. On the y-axis, the percentage of reaction positive for viral DNA at each cell dilution on the x-axis. There were no significant differences in latency establishment in infected HIF1αLoxP/LoxP (1 in 2,880 cells) and WT mice (1 in 2,346 cells) on 16 dpi (Fig 6A). The same splenocytes were assayed to measure the frequency of reactivating virus by ex vivo limiting dilution assay (LDA). Splenocytes were diluted 10-fold and co-cultured with primary MEFs for two weeks. The number for the frequency of cells reactivating was determined based on the Poisson distribution, which predicts that 0.1 PFU per well should result at 63% percent reactivation of wells positive for cytopathic effect (CPE) [40].
In contrast to latency establishment, significantly fewer splenocytes reactivated in HIF1αLoxP (1 in 73,181 splenocytes) mice when compared to WT infection (1 in 16,818, P = 0.0287) upon ex vivo culture as shown in Fig 6B. We also confirmed that the transgenic background did not affect the frequency of viral reactivation by LDA assay from splenocytes harvested from HIF1αLoxP/LoxP mice infected with wild type (MHV69-BAC) virus. We validated the excision of exon 2 in vivo on RNA isolated from lung tissue and bulk splenocytes on16 dpi. A 400 bp PCR product corresponding to the excised HIF1α gene was observed only in the lungs and splenocytes of HIF1αLoxP/LoxP mice infected with the MHV68-Cre virus (Fig 6C). A 600 bp product relating to full-length HIF1α gene in uninfected (naïve) or in WT mice infected with the same virus confirmed that Cre-recombinase was functional in vivo.
Ex vivo reactivation of MHV68-infected splenocytes in hypoxia enhances virus production
MHV68 lytic reactivation was negatively affected by Cre-virus-mediated inactivation of HIF1α, suggesting that it plays a role during the latent to lytic switch ex vivo in normoxic conditions. This is consistent with our results in Fig 3, which show that HIF1α deletion impairs de novo lytic replication. However, the impact of HIF1α activation during viral reactivation of γHV-infected cells derived from a natural host has not been explored.
Since low oxygen conditions stabilize and activate HIF1α, we sought to assess whether these conditions could affect the frequency of reactivation in MHV68-infected cells. Following latency establishment of a wild-type MHV68 infection in vivo, we carried out a limiting-dilution assay under 3% O2 or 21% O2 culture conditions, as performed in Fig 6. There was no significant difference in the average frequency of reactivating splenocytes in both oxygen levels (21% O2: 1 in 42,743 cells and 3% O2: 1 in 29,498 cells), as shown in Fig 7A. This indicates that HIF1 activation by low oxygen conditions does not affect the rate at which cells reactivate into lytic replication in MHV68-infected cells.
We then examined whether hypoxia would increase the amount of virus produced during the reactivation of latently infected cells. After MHV68 latency establishment in mice, explanted splenocytes were plated at different ratios on top of 1 X 105 MEFs and co-incubated at 21% O2 or 1% O2. Supernatants were collected after 4, 5, and 6 days in culture then titered by plaque assay. On day 4, MHV68 virus was not detected in normoxic conditions (21% O2) regardless of the splenocytes-to-MEFs ratio analyzed and within the limits of detection of the assay. In contrast, the infectious virus was already present at day 4 in all splenocytes-to-MEFs ratios reactivated in low oxygen conditions (Fig 7B). Moreover, no virus production was detected in the 1 : 10 splenocytes-to-MEFs ratio co-incubated at 21% O2 after 6 days while viral titers were detected and continued to expand in 1% O2 supernatants (Fig 7B - Left). On day 5, supernatants from 10 : 1 splenocytes-to-MEFs ratio at 1% O2 had the highest viral titers of up to 500-fold (Fig 7B - center) and with a 100-fold boost in 1 : 1 (Fig 7B - right) co-cultures when compared to 21% O2. Althought, no virus production was detected following 3 days in co-culture supernatant from either condition, mRNA analysis by qPCR revealed significantly higher RTA expression in hypoxic conditions when normalized to normoxic reactivation regardless of splenocytes to MEFs ratio (Fig 7C). Thus, our data show that hypoxia provides cellular conditions that accelerate and enhance viral production during reactivation from latency in the B-cell lineage, the primary reservoir of gammaherpesviruses. This is aligned with our finding in Fig 6B, showing that reactivation is impaired by loss of HIF1α, further reinforcing the idea that hypoxia and the HIF1α pathway play a role in gammaherpesvirus reactivation from latency.
Discussion
Understanding the role of the HIF1 pathway in the viral life cycle of oncogenic gammaherpesviruses is currently hindered by the lack of a suitable infection model. We present cumulative data indicating the importance of HIF1α in MHV68 lytic replication and reactivation from latency. In this study, we show that MHV68 activates the HIF1 pathway and that knock-out of HIF1α transcriptional activity diminished lytic replication in vitro and in an in vivo model of HIF knock-out of infected cells. Moreover, this truncated form of HIF1α impaired lytic reactivation of cells latently infected in vivo.
We show that MHV68 infection increased HIF1α protein levels. This was coupled with an increase in HIF1α -dependent transcription activity (Fig 1). A similar HIF upregulation was found in endothelial cells latently infected by KSHV [35], an oncogenic gammaherpesvirus that encodes many genes with the potential to upregulate HIF1α [15]. Although, the MHV68 viral genome is structurally similar to KSHV with many of the viral homologous [53] found to activate the HIF pathway in KSHV are also present in MHV68 but, the exact mechanisms whereby the virus could target the HIF1 pathway are still to be defined. A recent report shows that MHV68 activates IKKβ, a recently discovered transcriptional activator of HIF1α during cellular defense against microbes [54,55].
To further define the role of HIF1α in replication we generated knock-out cells (Fig 2). As a first approach, we employed the MHV68-Cre infection of primary MEFs from the HIF1αLoxP mouse strain to address the consequences of HIF1α deletion in lytic infection. However, we noticed that Cre-induced deletion was detectable only after 12 hpi while MHV68 infection upregulates HIF1α well before—between 4 and 8 hours (Fig 1A). Therefore, we resorted to create stable null cells and complement it with two other alternative inhibitory approaches. We found that the deletion of the DNA-binding motif in Null cells impaired viral replication (Fig 3A) and gene expression analysis of MHV68 viral HRE-containing promoters reveal an effect in 7 of 17 ORFs (Fig 2D and 2G and Fig 3). Our findings confirmed the conserved HREs within ORF50 previously published [29]. The majority of these HRE-containing viral genes have been described as essential for lytic replication, such as DNA replication and assembly of mature virions [31] (S1 Table). Out of these genes, particularly striking, is the downregulation of the KSHV homologous vGPCR gene in HIF1α Null Cells (Fig 3B). This is consistent with a recent report that also shows that KSHV vGPCR is a gene under strong regulation by HIF1α [25]. Since vGPCR is required for RTA gene and protein expression during lytic replication of KSHV [56], it is possible that vGPCR downregulation in the absence of HIF1α would hinder RTA participation in lytic gene expression.
We found that the upregulation of glycolytic enzymes by MHV68 during normoxic infection was impaired by HIF1α deletion (Fig 3D). Metabolic reprogramming by gammaherpesviruses occurs during KSHV and EBV de novo infection [21,57,58]. Previous results published by our laboratory showed that the glycolysis inhibitor 2-deoxyglucose (2DG) inhibited MHV68 lytic infection, which is consistent with our results point to the a role of HIF1α regulation of glycolytic genes as part of gammaherpesviruses strategy to reprogram glucose metabolism needed for replication.
Recent studies have demonstrated that low oxygen tension can either enhance or downregulate virus infection [13,59]. It is unknown whether low oxygen levels influence gammaherpesvirus lytic replication in the absence of HIF1α. We found that the MHV68 lytic program is more heavily influenced by HIF1α under lower oxygen conditions—similar to physiological levels of oxygen in tissues and cells [60]. We found that at 3% oxygen levels, MHV68 in HIF1α Null cells undergo a further significant replication impairment concomitant to a higher decrease in viral gene expression (Fig 4). The global expression of viral genes is affected during infection in Null cells but specially for HRE containing promoters. This could be the consequence of other transcription factors upregulated by an oxygen-depleted environment that could contribute to viral gene regulation [61,62] but, more likely, the fact that many non-HRE containing viral genes are regulated by HIF-regulated genes such as RTA. Taken together, our in vitro results in 21% O2 and 3% O2 show that HIF1α plays an important role in MHV68 replication and that this is due, at least in part, by a key role in the regulation of viral gene transcription.
HIF1α upregulation is one aspect of the regulation of the oxygen sensing machinery by γHVs such as KSHV and MHV68. In fact, KSHV infection was shown to upregulate HIF2α [35]. Since HIF1α and HIF2α could both overlap in the regulation of HRE-containing hypoxia-regulated genes, we were concerned as to whether it was also upregulated by MHV68 infection and therefore, could compensate for HIF1α loss in the depletion studies thus masking some of the biological consequences of HIF1α loss. As shown in S2 Fig and reported for KSHV infection [35], MHV68 does upregulate HIF2α. This observation precludes a possible role for HIF2α in compensating for HIF1α loss and masking the transcriptional consequences of HIF1α exon 2 deletion.
Infection of floxed transgenic mice with MHV68-Cre to knock-out HIF1α in vivo revealed that HIF1α is necessary for optimal viral expansion on the site of acute infection in the animal model. This is consistent with our data of Figs 1, 3 and 4 showing that HIF1α upregulation plays a role in MHV-68 de lytic infection by regulating its lytic genes. This could explain why the peak of viral titers are decreased in the lungs (Fig 5B and 5C). It is also likely that a reduction in viral expansion during the initial lytic phases in the lung could affect the extent of inflammation, explaining the significant decrease of IL1β production in lungs lysates on day 7 (Fig 5D). These findings suggest that in the gammaherpesvirus life cycle, HIF1α is necessary for lytic virus expansion during acute infection of its host.
Similar to other herpesviruses, acute replication of gammaherpesviruses is followed by the long-term establishment of latent reservoirs in the host. Although the frequency of latency establishment shown by nested PCR of bulk splenocytes on day 16 (Fig 6A) was the same between wild type and HIF1αLoxP mice after MHV68-Cre virus infection, we found that the frequency of ex vivo reactivation of lytic virus from latently infected splenocytes was impaired in the absence of HIF1α (Fig 6B). To further establish a possible role of HIF1α in reactivation from latency, we tested WT virus reactivation in a lower oxygen context that we have shown increase HIF1α levels and activity. We found that low oxygen concentrations accelerated MHV68 reactivation and significantly increased the number of infectious virions released concomitantly with viral RTA upregulation. Our data further points to a critical role of HIF in gammaherpesvirus infection as it is likely to affect not only viral replication but viral reactivation in tissues where there is a lower physiological oxygen level. It previously found that exposure of KSHV and EBV infected cells to hypoxic conditions can trigger a latent to lytic replication switch and enhance viral production and reactivation [13,63]. This likely happens via interaction of HIF1α with the transcriptional machinery that regulates viral expression. In KSHV, the expression of the Replication and Transcription Activation (RTA) and a lytic gene cluster is enhanced by HIF1α in complex with viral-encoded proteins such as the Latency-Associated Nuclear Antigen (LANA) [34,64]. Similarly, in EBV positive cell lines, HIF1α binds HREs located within the promoter region of the latent-lytic switch gene, BZLF1 [14].
Both in KSHV and EBV, HIF1α has been linked to metabolic reprogramming of the host cell, modulation of viral latency, lytic replication, and tumorigenesis. Our work further contributes to the understanding of the HIF1 pathway during the productive viral cycle in a natural infection and lytic replication in a cell and animal model. It establishes the utility of MHV68 as a model that can further our understanding of the mechanisms whereby gammaherpesviruses interact with oxygen-sensing pathways. Our data also opens up new avenues to dissect the contribution of HIF1α in gammaherpesvirus infection of specific cell types such as myeloid and naïve and memory B cells that are targeted by MHV68 in vivo and can lead to lymphomagenesis under immunosuppression [65]. Our findings demonstrate the importance of the interplay of the oxygen sensing machinery and gammaherpesviruses, which is key to understand their pathobiology.
Methods
Mice
Mice containing germline floxed exon 2 of HIF1α gene (HIF1αLoxP/LoxP) on a B6.129 background were purchased from Jackson Labs and together with age - and sex-matched with wild-type C57BL/6 J mice were bred and maintained at our institute animal facility. Female mice at 8 - to 12-week-old were used in groups of three to nine in most experiments. A mixture of Ketabime and Xylazine was used for anesthesia before intranasal inoculation. Mice were euthanized by low and long exposure of carbon dioxide for the collection of tissues. The animal experiments described here were performed according to the approved protocol by the University of Miami Miller School of Medicine Institutional Animal Care and Use Committee. In addition, we report compliance with the ARRIVE guidelines as a requirement for reporting in vivo animal experiments.
Virus stock
MHV68 containing Cre-recombinase (MHV68-Cre) driven by human cytomegalovirus promoter and parental MHV68-BAC virus were kindly provided by Dr. Samuel Speck, Emory University, Atlanta. MHV68-WUMS strain was obtained from Dr. Herbert Virgin, University of Washington, St. Louis. Viral stocks were prepared by low MOI infection of 3T12 cells in 2% FBS complete medium. Virus stocks were harvested after 5 to 7 days of infection and were processed by a freeze-thawed cycle followed by homogenization. Subsequently, virus lysate was purified by centrifugation at 1,000 rpm for 10 minutes, and the supernatant was filtered thru 0.4μm membrane to remove cell debris. Finally, purified virus stock was prepared by ultracentrifugation at 27,000 rpm for 1 hour at 4°C, and aliquots were transferred to -80°C for long-term storage. Viruses were quantified on 3T12 cells by standard plaque assay. Briefly, supernatants were diluted in 10-fold and transferred to cells layer in 24-well plates and incubated for 2 hours. 0.75% CMC containing overlay with 2% FBS complete media was added after inoculation. UV inactivation of viral stock was performed on a 60-mm plate in a Stratalinker, followed by plaque titration to ensure viral inactivation.
Cell culture
NIH 3T12 (ATCC CCL-164), a fibroblast cell line permissive to MHV68 replication, was used to test the status of HIF1α after infection with MHV68-WUMS Strain. For all subsequent in vitro studies to test the absence of HIF1α activity, murine embryonic fibroblasts (MEFs) were immortalized using the 3T3 NIH method. Briefly, MEFs were obtained from C57BL6 and B6. HIF1α2loxp at 13.5 to 15.5 days post-coitus and cultured in T-25 flasks at 3X105 cells every 3 days until passage 32. Immortalized HIF1αLoxP/LoxP MEFs were generated by lentiviral transduction of Cre-recombinase and selected by Blasticidin. MEFs and 3T12 were cultured at 37°C with 5% CO2 in Dulbecco modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS), 2μM L-glutamine, 10μg/ml of gentamicin. The HIF-1 inhibitor PX-478 (S7612, Selleck Chemical) was used as an alternative approach to block availability and HIF1 function.
Low oxygen treatment
In experiments that required low oxygen concentration, cells were cultured in a humid hypoxia chamber under a mixture of O2/ CO2/ N2. To obtain physiological oxygen concentrations or 3% O2 conditions, 3 : 5:92 vol% and 1% O2, 1 : 5:94 vol%. Hypoxia mimic was achieved by treatment with Cobalt chloride (Roche) at 150μM.
Excision assay
Cells were lysed in RLT buffer (Qiagen) supplemented with 1% β-mercaptoethanol and stored at -80°C before RNA extraction. RNA was isolated using RNeasy minikit (Qiagen), and cDNA was prepared using ImProm-II Reverse Transcription System (Promega) according to manufacturer’s instruction. PCR conditions were as follow 95°C for 2 minutes followed by 32 cycles of 95°C for 30 seconds, 64°C for 45 seconds and 72°C for 45 seconds. Excision was demonstrated by a shift in the size the mRNA fragment spanning exon 1 to exon 5 (600bp), which upon deletion of exon 2 can be detected in a 2.5% DNA agarose gel as a 400bp fragment when amplified by PCR (Invitrogen). Wild type MEFs isolated from C57Bl/6J mice transduced with the cre-recombinase expressing lentivirus was used as a control to detect the specificity of excision in floxed HIF MEFs. Primer sets were purchased from Sigma at follows: exon 1 forward 5’ - CCGGCGGCGAGAAG -3’ and exon 5 reverse 5’ - CCACGTTGCTGACTTGATGTTCAT - 3’.
Reporter and expression plasmids
Transfection of the cell lines 3T12, MEFs and 293AD were performed by using Lipofectamine 2000 following manufacturer’s protocol. HRE-luciferase was a gift from Navdeep Chandel (Addgene plasmid # 26731; http://n2t.net/addgene:26731; RRID: Addgene_26731). The HRE-Luciferase reporter is a pGL2 vector containing three hypoxia response elements from the Pgk-1 gene upstream of firefly luciferase [66]. TK-Renilla and HRE-luciferase plasmids were co-transfected to control for transfection efficiency. In addition, pGL2-Basic (empty vector/ negative control) and pGL2-Control (positive control) was used to detect any non-specific luciferase activity. After 12 hours of transfection, cells were infected with MHV68 at low (0.5 PFU/cell) and high MOIs (3.0 PFU/cell). Firefly luciferase and Renilla activity in cell lysates were measured using Dual Luciferase Assay System (Promega Corporation), as recommended by the manufacturer using a luminometer. Relative light units of Luciferase were normalized against light units of Renilla for transfection efficiency. Results are displayed as fold-induction determined by normalizing to either 21% O2, uninfected conditions, or both. The luciferase reporter for PGK1 HRE mutant was created using Q5® Site-Directed Mutagenesis Kit (New England Biolabs) and with primers designed to substitute the three HREs consensus from ACGTCCTGCA to TTGTCCTGTT using the NEBaseChanger® tool. Fwd primer 5’ - CTGTTCGACTCTAGTTGTCTTGTCCTGTTGCTCGAGATCCGGCCCCG and primer Rv 3’-GACAAGACAACTAGAGTCGAACAGGACAAGACAGAGCTCGGTACCTCCC. The MHV68ORF74 promoter luciferase reporter contains the region spanning nucleotides (nt) -597 to 0 that are found upstream of the starting codon for the MHV68 vGPCR gene. The viral promoter regions were amplified from DNA of MHV68 infected 3T12 cells by PCR with primers ORF74 Fwd (5’–CAGAGGTACCATGCGG TTTTTGATACCTGGAGTATCTTTTTGGTGGAGGG - 3’) and ORF74 Rv (5’-CGTGGCA CGCGTGGTGGCGGCCTCACTCAGTCTGTCTTTCTTGCAGAGTCAGAAGTAGAGAAAC - 3’). Primers contain Kpn1 and Mlu1 sites, respectively (underlined). The PCR fragment was inserted into the corresponding sites of the reporter vector pGL2-Basic (Promega) to generate viral gene promoter reporter. The expression plasmid for pcDNA3.1/nV5-DEST vector containing the MHV68 ORF50 gene was a gift by the laboratory of Dr. James C. Forrest. The pcDNA mHIF-1a MYC (P402A/P577A/N813A) was a gift from Celeste Simon (Addgene plasmid # 44028; http://n2t.net/addgene:44028; RRID: Addgene_44028). siGENOME HIF1α siRNA and Non-Targeting siRNA pool was purchased from Dharmacon (Chicago, IL).
Western blot
Samples were lysed in RIPA buffer and sonicated to avoid clumps from genomic DNA in lysates. Protein concentration was determined with BCA assay (Thermo Scientific) prior to resuspending in Laemmli buffer. Protein lysates were separated by SDS-PAGE and transferred to a PDVF membrane (Pall Life Sciences). Primary and secondary antibodies were diluted in 3% fat-free milk. Recombinant Rabbit Anti HIF1α antibody (ab179483, Abcam), Anti-actin antibody (A5316, Sigma) and Recombinant Rabbit Anti-HIF2α (Novus Biologics, NB100-122). Primary antibodies were detected with HRP - conjugated secondary antibody (Sigma) and revealed by chemiluminescence reagent (Thermo Scientific).
Real-time qPCR
Cells were lysed in RLT buffer (Qiagen) supplemented with 1% β-mercaptoethanol and stored at -80°C before RNA extraction. RNA was isolated using RNeasy minikit (Qiagen) and cDNA was prepared using ImProm-II Reverse Transcription System (Promega) according to manufacturer’s instruction. Quantitative PCR was performed with 10 to 50 ng of cDNA using SyBr Green (Quanta Biosciences). PCR conditions were 95°C for 5 minutes followed by 45 cycles of 95°C for 10 seconds, 60°C for 20 seconds and 72°C for 30 seconds. The TATA-binding site mRNA was used as the housekeeping gene. We compared the normalized Ct values (ΔCt) of each gene in two biological replicates between two groups of samples. All relative fold-change values were normalized against normoxic conditions using 2-ΔΔCt to display fold-change.
In vitro viral infections
Viral infections were performed in low volume serum-free complete media at 4°C for 2 hours at 21% O2. Cell layers were washed twice with 1X PBS and then 2% FBS complete medium was added for experiments. For RNA and protein analysis, cell layer was washed once with cold 1X PBS.
Viral pathogenesis assays
Wild type and HIF1α-LoxP mice were euthanized with ketamine (100mg/kg) and xylazine (10mg/kg) and infected with 3x104 PFU of MHV68-Cre virus. Lungs were removed on days 3, 5 and 7 post infection and freezed-thawed prior to processing. Tissue was disrupted in 1ml of 2% FBS complete medium using a handheld Omni homogenizer (www.OMNI-INC.com). Viral titers were determined by plaque assay on 3T12 cells plated in 24 well-plates and cultured in 0.75% CMC-overlay medium.
Limiting dilution assay
Bulk splenocytes were serially diluted by 2-fold on days 16 and 42 post infection after RBC lysis and plated on primary MEF starting at 1X 105 cells/well down to 7.5X102 cells/well with replicates of 24-well per dilution in 96-well plate. After 3 weeks, sups were collected and re-plated into 3T12 cells to amplify the virus and cytopathic effects was scored.
Viral genome frequency
Splenocytes were thawed and counted and diluted in 104 uninfected 3T12 cells. After proteinase K treatment, two rounds of PCR were performed against MHV68 ORF50. Copies of a plasmid containing ORF50 in 10, 1 and 0.1 copies were diluted against 1X104 3T12 cells and amplified in each run to ensure sensitivity of assay.
Virus reactivation of splenocytes in low oxygen
At day 16 following intranasal infection, (n = 3) spleens were processed to obtain splenocytes at a single-cell suspension. Explanted splenocytes were plated at different quantities (104, 105 and 106) on top of a MEFs layer (1X105 cells per well) in a 6-well plate in duplicates. The-co-culture was kept in 2-ml of 2% FBS complete 1X DMEM media then transfer to 21% O2 or 1% O2 conditions.
Identification of HRE sequences within viral sequences
Computer-assisted prediction of HIF1α binding sites within the 500bp upstream of MHV68 ORFs was performed with TESS (Transcription Element Search System) using TRANSFAC for the search string RCGCT allowing only core position for strings with a maximum allowable string mismatch of %10.
Enzyme - linked immunosorbent assay
IL-1β and TNF-α were quantified by a mouse ELISA Ready-SET-Go! Kit (Affimetrix, eBioscience San Diego, CA). Plates were prepared and assayed according to the manufacturer’s protocol and signals were read at 450 nm and subtracted the values of 570 nm to those of 450 nm.
Statistical analyses
Data analysis was perform using Prism software (Graphpad). Viral titer, reporter assays and mRNA fold-change was analyzed with a two-tailed Student t test and values are expressed as the means of standard error. Frequencies of reactivation and viral DNA positive cells were determined within the nonlinear regression fit of the results on the regression line that intersected at 63.2%, following a Poisson distribution. Results were considered to be statistically significant for values of P<0.05.
Supporting information
S1 Fig [mefs]
Deletion of HIF1α DNA-binding domain suppresses HRE-dependent transcription in hypoxia.
S2 Fig [a]
HIF2α protein expression during MHV68 lytic replication.
S1 Table [tif]
Absence of HIF1α impairs gammaherpesvirus gene in low oxygen levels.
Zdroje
1. Semenza GL. Oxygen sensing, hypoxia-inducible factors, and disease pathophysiology. Annu Rev Pathol. 2014 Jan;9 : 47–71. doi: 10.1146/annurev-pathol-012513-104720 23937437
2. Semenza G. Signal transduction to hypoxia-inducible factor 1. Biochem Pharmacol. 2002 Sep;64(5–6):993–8. doi: 10.1016/s0006-2952(02)01168-1 12213597
3. Greer SN, Metcalf JL, Wang Y, Ohh M, Ahn B, Kim H, et al. The updated biology of hypoxia-inducible factor. EMBO J. 2012 May 30;31(11):2448–60. doi: 10.1038/emboj.2012.125 22562152
4. Wakisaka N, Kondo S, Yoshizaki T, Murono S, Furukawa M, Pagano JS. Epstein-Barr virus latent membrane protein 1 induces synthesis of hypoxia-inducible factor 1 alpha. Mol Cell Biol. 2004 Jun;24(12):5223–34. doi: 10.1128/MCB.24.12.5223-5234.2004 15169887
5. McFarlane S, Nicholl MJ, Sutherland JS, Preston CM. Interaction of the human cytomegalovirus particle with the host cell induces hypoxia-inducible factor 1 alpha. Virology. 2011;414(1):83–90. doi: 10.1016/j.virol.2011.03.005 21481907
6. Haeberle HA, Dürrstein C, Rosenberger P, Hosakote YM, Kuhlicke J, Kempf VAJ, et al. Oxygen-independent stabilization of hypoxia inducible factor (HIF)-1 during RSV infection. PLoS One. 2008;3(10):14–6.
7. Werth N, Beerlage C, Rosenberger C, Yazdi AS, Edelmann M, Amr A, et al. Activation of hypoxia inducible factor 1 is a general phenomenon in infections with human pathogens. Ho PL, editor. PLoS One. 2010 Jan;5(7):e11576.
8. Piña-oviedo S, Khalili K, Del Valle L. Hypoxia inducible factor-1 alpha activation of the JCV promoter: role in the pathogenesis of Progressive Multifocal Leukoencephalopathy Sergio. Acta Neuropathol. 2009;118(2):235–47. doi: 10.1007/s00401-009-0533-0 19360424
9. Ren L, Zhang W, Han P, Zhang J, Zhu Y, Meng X, et al. Influenza A virus (H1N1) triggers a hypoxic response by stabilizing hypoxia-inducible factor-1α via inhibition of proteasome. Virology. 2019;530(November 2018):51–8.
10. Davis DA, Rinderknecht AS, Zoeteweij JP, Aoki Y, Read-Connole EL, Tosato G, et al. Hypoxia induces lytic replication of Kaposi sarcoma–associated herpesvirus. Blood. 2001;97(10).
11. Zhang L, Zhu C, Guo Y, Wei F, Lu J, Qin J, et al. Inhibition of KAP1 enhances hypoxia-induced KSHV reactivation through RBP-Jκ. J Virol. 2014 Apr 2;JVI.00283-14-.
12. Shrestha P, Davis DA, Veeranna RP, Carey RF, Viollet C, Yarchoan R. Hypoxia-inducible factor-1 alpha as a therapeutic target for primary effusion lymphoma. 2017;1 : 1–20.
13. Jiang JH, Wang N, Li A, Liao WT, Pan ZG, Mai SJ, et al. Hypoxia can contribute to the induction of the Epstein-Barr virus (EBV) lytic cycle. J Clin Virol. 2006;37(2):98–103. doi: 10.1016/j.jcv.2006.06.013 16931136
14. Kraus RJ, Yu X, Cordes BA, Sathiamoorthi S, Iempridee T, Nawandar DM, et al. Hypoxia-inducible factor-1 alpha plays roles in Epstein-Barr virus’s natural life cycle and tumorigenesis by inducing lytic infection through direct binding to the immediate-early BZLF1 gene promoter. PLOS Pathog. 2017;13(6):e1006404. doi: 10.1371/journal.ppat.1006404 28617871
15. Morinet F, Casetti L, François J-H, Capron C, Pillet S. Oxygen tension level and human viral infections. Virology. 2013;444(1):31–6.
16. Anderson LA, Lauria C, Romano N, Brown EE, Whitby D, Graubard BI, et al. Risk factors for classical Kaposi sarcoma in a population-based case-control study in Sicily. Cancer Epidemiol Biomarkers Prev. 2008 Dec;17(12):3435–43. doi: 10.1158/1055-9965.EPI-08-0671 19064559
17. Sobngwi E, Choukem SP, Agbalika F, Blondeau B, Fetita L-S, Lebbe C, et al. Ketosis-prone type 2 diabetes mellitus and human herpesvirus 8 infection in sub-saharan africans. JAMA. 2008 Jun 18;299(23):2770–6. doi: 10.1001/jama.299.23.2770 18560004
18. Chang Y, Cesarman E, Pessin MS, Lee F, Culpepper J, Knowles DM, et al. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi’s sarcoma. Science. 1994 Dec 16;266(5192):1865–9. doi: 10.1126/science.7997879 7997879
19. Cesarman E, Chang Y, Moore PS, Said JW, Knowles DM. Kaposi’s sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N Engl J Med. 1995 May 4;332(18):1186–91. doi: 10.1056/NEJM199505043321802 7700311
20. Yogev O, Lagos D, Enver T, Boshoff C. Kaposi’s sarcoma herpesvirus microRNAs induce metabolic transformation of infected cells. PLoS Pathog. 2014 Sep 25;10(9):e1004400. doi: 10.1371/journal.ppat.1004400 25255370
21. Delgado T, Carroll P a, Punjabi AS, Margineantu D, Hockenbery DM, Lagunoff M. Induction of the Warburg effect by Kaposi’s sarcoma herpesvirus is required for the maintenance of latently infected endothelial cells. Proc Natl Acad Sci U S A. 2010 Jun 8;107(23):10696–701. doi: 10.1073/pnas.1004882107 20498071
22. Bais C, Santomasso B, Coso O, Arvanitakis L, Raaka EG, Gutkind JS, et al. G-protein-coupled receptor of Kaposi’s sarcoma-associated herpesvirus is a viral oncogene and angiogenesis activator. Nature. 1998 Jan 1;391(6662):86–9. doi: 10.1038/34193 9422510
23. Jham BC, Ma T, Hu J, Chaisuparat R, Friedman ER, Pandolfi PP, et al. Amplification of the angiogenic signal through the activation of the TSC/mTOR/HIF axis by the KSHV vGPCR in Kaposi’s sarcoma. PLoS One. 2011 Jan;6(4):e19103. doi: 10.1371/journal.pone.0019103 21559457
24. Ma T, Patel H, Babapoor-Farrokhran S, Franklin R, Semenza GL, Sodhi A, et al. KSHV induces aerobic glycolysis and angiogenesis through HIF-1-dependent upregulation of pyruvate kinase 2 in Kaposi’s sarcoma. Angiogenesis. 2015 Oct;18(4):477–88. doi: 10.1007/s10456-015-9475-4 26092770
25. Singh RK, Lang F, Pei Y, Jha HC, Robertson S. Metabolic reprogramming of Kaposi ‘ s sarcoma associated herpes virus infected B - cells in hypoxia. PLoS Pathog. 2018;14(5):1–28.
26. Viollet C, Davis DA, Tekeste SS, Reczko M, Ziegelbauer JM, Pezzella F, et al. RNA Sequencing Reveals that Kaposi Sarcoma-Associated Herpesvirus Infection Mimics Hypoxia Gene Expression Signature. PLOS Pathog. 2017;13(1):e1006143. doi: 10.1371/journal.ppat.1006143 28046107
27. Zhang L, Zhu C, Guo Y, Wei F, Lu J, Qin J, et al. Inhibition of KAP1 Enhances Hypoxia-Induced Kaposi’s Sarcoma-Associated Herpesvirus Reactivation through RBP-Jκ. J Virol. 2014 Jun 15;88(12):6873–84. doi: 10.1128/JVI.00283-14 24696491
28. Davis DA, Rinderknecht AS, Zoeteweij JP, Aoki Y, Read-Connole EL, Tosato G, et al. Hypoxia induces lytic replication of Kaposi sarcoma-associated herpesvirus. Blood. 2001 May 15;97(10):3244–50. doi: 10.1182/blood.v97.10.3244 11342455
29. Polcicova K, Hrabovska Z, Mistrikova J, Tomaskova J, Pastorek J, Pastorekova S, et al. Up-regulation of Murid herpesvirus 4 ORF50 by hypoxia: possible implication for virus reactivation from latency. Virus Res. 2008 Mar;132(1–2):257–62. doi: 10.1016/j.virusres.2007.12.004 18221814
30. Mesri E, Cesarman E, Boshoff C. Kaposi’s sarcoma and its associated herpesvirus. Nat Rev Cancer. 2010 Oct;10(10):707–19. doi: 10.1038/nrc2888 20865011
31. Barton E, Mandal P, Speck SH. Pathogenesis and host control of gammaherpesviruses: lessons from the mouse. Annu Rev Immunol. 2011 Jan;29 : 351–97. doi: 10.1146/annurev-immunol-072710-081639 21219186
32. Epstein ACR, Gleadle JM, McNeill LA, Hewitson KS, O’Rourke J, Mole DR, et al. C. elegans EGL-9 and Mammalian Homologs Define a Family of Dioxygenases that Regulate HIF by Prolyl Hydroxylation. Cell. 2001 Oct 5;107 : 43–54. doi: 10.1016/s0092-8674(01)00507-4 11595184
33. Tang N, Wang L, Esko J, Giordano FJ, Huang Y, Gerber H-P, et al. Loss of HIF-1alpha in endothelial cells disrupts a hypoxia-driven VEGF autocrine loop necessary for tumorigenesis. Cancer Cell. 2004 Dec;6(5):485–95. doi: 10.1016/j.ccr.2004.09.026 15542432
34. Cai Q, Lan K, Verma SC, Si H, Lin D, Robertson ES. Kaposi’s sarcoma-associated herpesvirus latent protein LANA interacts with HIF-1 alpha to upregulate RTA expression during hypoxia: Latency control under low oxygen conditions. J Virol. 2006 Aug;80(16):7965–75. doi: 10.1128/JVI.00689-06 16873253
35. Carroll PA, Kenerson HL, Yeung RS, Lagunoff M. Latent Kaposi’s sarcoma-associated herpesvirus infection of endothelial cells activates hypoxia-induced factors. J Virol. 2006 Nov;80(21):10802–12. doi: 10.1128/JVI.00673-06 16956952
36. Huang Y, Lei L, Liu D, Jovin I, Russell R, Johnson RS, et al. Normal glucose uptake in the brain and heart requires an endothelial cell-specific HIF-1α-dependent function. Proc Natl Acad Sci U S A. 2012 Oct 23;109(43):17478–83. doi: 10.1073/pnas.1209281109 23047702
37. Singh RK, Lang F, Pei Y, Jha HC, Robertson ES. Metabolic reprogramming of Kaposi’s sarcoma associated herpes virus infected B - cells in hypoxia.
38. Koh MY, Spivak-kroizman T, Venturini S, Welsh S, Williams RR, Kirkpatrick DL, et al. Molecular mechanisms for the activity of PX-478, an antitumor inhibitor of the hypoxia-inducible factor-1 A. 2008;7(January):90–101.
39. Nathan AT, Singer M. The oxygen trail: tissue oxygenation. Br Med Bull. 1999 Jan 1;55(1):96–108. doi: 10.1258/0007142991902312 10695081
40. Moser JM, Upton JW, Allen RD, Wilson CB, Speck SH. Role of B-cell proliferation in the establishment of gammaherpesvirus latency. J Virol. 2005 Aug;79(15):9480–91. doi: 10.1128/JVI.79.15.9480-9491.2005 16014911
41. Semenza GL. Regulation of mammalian O2 homeostasis by hypoxia-inducible factor 1. Annu Rev Cell Dev Biol. 1999 Jan;15 : 551–78. doi: 10.1146/annurev.cellbio.15.1.551 10611972
42. Reese TA, Wakeman BS, Choi HS, Hufford MM, Huang SC, Zhang X, et al. Helminth infection reactivates latent -herpesvirus via cytokine competition at a viral promoter. Science (80-). 2014 Jun 26;345(6196):573–7.
43. Stevenson PG, May JS, Connor V, Efstathiou S. Vaccination against a hit-and-run viral cancer. J Gen Virol. 2010 Sep;91(Pt 9):2176–85. doi: 10.1099/vir.0.023507-0 20573854
44. Dutia BM, Reid SJ, Drummond DD, Ligertwood Y, Bennet I, Rietberg W, et al. A novel Cre recombinase imaging system for tracking lymphotropic virus infection in vivo. Stevenson PG, editor. PLoS One. 2009 Jan;4(8):e6492. doi: 10.1371/journal.pone.0006492 19652715
45. Hughes DJ, Kipar A, Sample JT, Stewart JP. Pathogenesis of a Model Gammaherpesvirus in a Natural Host. J Virol. 2010;
46. Sarawar SR, Cardin RD, Brooks JW, Mehrpooya M, Tripp RA, Sarawar SR, et al. Cytokine production in the immune response to murine gammaherpesvirus 68. Cytokine Production in the Immune Response to Murine Gammaherpesvirus 68. 1996;70(5).
47. Sarawar SR, Lee BJ, Anderson M, Teng YC, Zuberi R, Von Gesjen S. Chemokine induction and leukocyte trafficking to the lungs during murine gammaherpesvirus 68 (MHV-68) infection. Virology. 2002;293(1):54–62. doi: 10.1006/viro.2001.1221 11853399
48. Bortz E, Wu TT, Patel P, Whitelegge JP, Sun R. Proteomics of bronchoalveolar lavage fluid reveals a lung oxidative stress response in murine herpesvirus-68 infection. Viruses. 2018;10(12).
49. Sunil-Chandra NP, Efstathiou S, Arno J, Nash AA. Virological and pathological features of mice infected with murine gammaherpesvirus 68. J Gen Virol. 1992;
50. Nash AA, Dutia BM, Stewart JP, Davison AJ. Natural history of murine gamma-herpesvirus infection. Philos Trans R Soc Lond B Biol Sci. 2001 Apr 29;356(1408):569–79. doi: 10.1098/rstb.2000.0779 11313012
51. Weck KE, Barkon ML, Yoo LI, Speck SH, Virgin HW I V. Mature B cells are required for acute splenic infection, but not for establishment of latency, by murine gammaherpesvirus 68. J Virol. 1996 Oct;70(10):6775–80. 8794315
52. Weck KE, Kim SS, Virgin HW I V, Speck SH. B cells regulate murine gammaherpesvirus 68 latency. J Virol. 1999 Jun;73(6):4651–61. 10233924
53. Cesarman E, Damania B, Krown S, Martin J, Bower M, Whitby D. Kaposi sarcoma. Nat Rev Dis Prim. 2019;681–3.
54. Rius J, Guma M, Schachtrup C, Akassoglou K, Zinkernagel AS, Nizet V, et al. NF-kappaB links innate immunity to the hypoxic response through transcriptional regulation of HIF-1alpha. Nature. 2008 Jun 5;453(7196):807–11. doi: 10.1038/nature06905 18432192
55. Dong X, Feng H, Sun Q, Li H, Wu T-T, Sun R, et al. Murine gamma-herpesvirus 68 hijacks MAVS and IKKbeta to initiate lytic replication. Früh K, editor. PLoS Pathog. 2010 Jan;6(7):e1001001. doi: 10.1371/journal.ppat.1001001 20686657
56. Bottero V, Sharma-Walia N, Kerur N, Paul AG, Sadagopan S, Cannon M, et al. Kaposi Sarcoma-associated herpes virus (KSHV) G protein-coupled receptor (vGPCR) activates the ORF50 lytic switch promoter: A potential positive feedback loop for sustained ORF50 gene expression. Virology. 2009;
57. Delgado T, Carroll PA, Punjabi AS, Margineantu D, Hockenbery DM, Lagunoff M. Induction of the Warburg effect by Kaposi’s sarcoma herpesvirus is required for the maintenance of latently infected endothelial cells. Proc Natl Acad Sci U S A. 2010 Jun 8;107(23):10696–701. doi: 10.1073/pnas.1004882107 20498071
58. Zhu Y, Ramos da Silva S, He M, Liang Q, Lu C, Feng P, et al. An Oncogenic Virus Promotes Cell Survival and Cellular Transformation by Suppressing Glycolysis. PLoS Pathog. 2016;12(5):1–27.
59. Hwang IIL, Watson IR, Der SD, Ohh M. Loss of VHL confers hypoxia-inducible factor (HIF)-dependent resistance to vesicular stomatitis virus: role of HIF in antiviral response. J Virol. 2006 Nov;80(21):10712–23. doi: 10.1128/JVI.01014-06 16928739
60. Nathan AT, Singer M. The oxygen trail: tissue oxygenation. Br Med Bull. 1999;55(1):96–108. doi: 10.1258/0007142991902312 10695081
61. Dalton-Griffin L, Wilson SJ, Kellam P. X-box binding protein 1 contributes to induction of the Kaposi’s sarcoma-associated herpesvirus lytic cycle under hypoxic conditions. J Virol. 2009;83(14):7202–9. doi: 10.1128/JVI.00076-09 19403667
62. Cummins EP, Taylor CT. Hypoxia-responsive transcription factors. Pflügers Arch. 2005;450(6):363–71. doi: 10.1007/s00424-005-1413-7 16007431
63. Davis DA. Hypoxia induces lytic replication of Kaposi sarcoma-associated herpesvirus. Blood. 2001 May 15;97(10):3244–50. doi: 10.1182/blood.v97.10.3244 11342455
64. Haque M, Wang V, Davis D a, Zheng Z-M, Yarchoan R. Genetic organization and hypoxic activation of the Kaposi’s sarcoma-associated herpesvirus ORF34-37 gene cluster. J Virol. 2006 Jul;80(14):7037–51. doi: 10.1128/JVI.00553-06 16809309
65. Sunil-Chandra NP, Arno J, Fazakerley J, Nash a a. Lymphoproliferative disease in mice infected with murine gammaherpesvirus 68. Am J Pathol. 1994 Oct;145(4):818–26. 7943173
66. Emerling BM, Weinberg F, J-L, Mak TW, Chandel NS. PTEN regulates p300-dependent hypoxia-inducible factor 1 transcriptional activity through Forkhead transcription factor 3a (FOXO3a). Proc Natl Acad Sci U S A. 2008 Feb 19;105(7):2622–7. doi: 10.1073/pnas.0706790105 18268343
Štítky
Hygiena a epidemiológia Infekčné lekárstvo LaboratóriumČlánok vyšiel v časopise
PLOS Pathogens
2019 Číslo 12
- Parazitičtí červi v terapii Crohnovy choroby a dalších zánětlivých autoimunitních onemocnění
- Očkování proti virové hemoragické horečce Ebola experimentální vakcínou rVSVDG-ZEBOV-GP
- Koronavirus hýbe světem: Víte jak se chránit a jak postupovat v případě podezření?
-
Všetky články tohto čísla
- A dispensable paralog of succinate dehydrogenase subunit C mediates standing resistance towards a subclass of SDHI fungicides in Zymoseptoria tritici
- A novel genetic circuitry governing hypoxic metabolic flexibility, commensalism and virulence in the fungal pathogen Candida albicans
- Coxiella burnetii Type 4B Secretion System-dependent manipulation of endolysosomal maturation is required for bacterial growth
- Distinct rates and patterns of spread of the major HIV-1 subtypes in Central and East Africa
- Iron availability and oxygen tension regulate the Yersinia Ysc type III secretion system to enable disseminated infection
- Shigella sonnei infection of zebrafish reveals that O-antigen mediates neutrophil tolerance and dysentery incidence
- IgG3 enhances neutralization potency and Fc effector function of an HIV V2-specific broadly neutralizing antibody
- Linking the effects of helminth infection, diet and the gut microbiota with human whole-blood signatures
- IgG Fc-binding motif-conjugated HIV-1 fusion inhibitor exhibits improved potency and in vivo half-life: Potential application in combination with broad neutralizing antibodies
- Small RNAs and extracellular vesicles: New mechanisms of cross-species communication and innovative tools for disease control
- Protein–RNA interactions important for Plasmodium transmission
- Human immunity to Toxoplasma gondii
- Identification of binding residues between periplasmic adapter protein (PAP) and RND efflux pumps explains PAP-pump promiscuity and roles in antimicrobial resistance
- Childhood immune imprinting to influenza A shapes birth year-specific risk during seasonal H1N1 and H3N2 epidemics
- Silencing of transcription factor encoding gene StTCP23 by small RNAs derived from the virulence modulating region of potato spindle tuber viroid is associated with symptom development in potato
- IL-23 supports host defense against systemic Candida albicans infection by ensuring myeloid cell survival
- ALVAC-HIV B/C candidate HIV vaccine efficacy dependent on neutralization profile of challenge virus and adjuvant dose and type
- Novel and emerging sources of Clostridioides difficile infection
- Organising the cell cycle in the absence of transcriptional control: Dynamic phosphorylation co-ordinates the Trypanosoma brucei cell cycle post-transcriptionally
- Neisseria gonorrhoeae Infects the Heterogeneous Epithelia of the Human Cervix Using Distinct Mechanisms
- Structural evidence for the critical role of the prion protein hydrophobic region in forming an infectious prion
- IL-22 produced by type 3 innate lymphoid cells (ILC3s) reduces the mortality of type 2 diabetes mellitus (T2DM) mice infected with Mycobacterium tuberculosis
- Pathogenicity island excision during an infection by Salmonella enterica serovar Enteritidis is required for crossing the intestinal epithelial barrier in mice to cause systemic infection
- Disrupting MLV integrase:BET protein interaction biases integration into quiescent chromatin and delays but does not eliminate tumor activation in a MYC/Runx2 mouse model
- The alternative cap-binding complex is required for antiviral defense in vivo
- Identification of new antiviral agents against Kaposi’s sarcoma-associated herpesvirus (KSHV) by high-throughput drug screening reveals the role of histamine-related signaling in promoting viral lytic reactivation
- Therapeutic monoclonal antibody treatment protects nonhuman primates from severe Venezuelan equine encephalitis virus disease after aerosol exposure
- Longitudinal bioluminescent imaging of HIV-1 infection during antiretroviral therapy and treatment interruption in humanized mice
- The pandemic Escherichia coli sequence type 131 strain is acquired even in the absence of antibiotic exposure
- Cooperation between somatic mutation and germline-encoded residues enable antibody recognition of HIV-1 envelope glycans
- A parasite’s take on the evolutionary cell biology of MICOS
- Herpes simplex encephalitis in adult patients with MASP-2 deficiency
- Mouse APOBEC3 interferes with autocatalytic cleavage of murine leukemia virus Pr180gag-pol precursor and inhibits Pr65gag processing
- Identification of viral SIM-SUMO2-interaction inhibitors for treating primary effusion lymphoma
- Full-length human cytomegalovirus terminase pUL89 adopts a two-domain structure specific for DNA packaging
- Deep sequence analysis of HIV adaptation following vertical transmission reveals the impact of immune pressure on the evolution of HIV
- Alpha-defensin 5 differentially modulates adenovirus vaccine vectors from different serotypes in vivo
- Fluorescent Crimean-Congo hemorrhagic fever virus illuminates tissue tropism patterns and identifies early mononuclear phagocytic cell targets in IFNAR-/- mice
- KSHV activates unfolded protein response sensors but suppresses downstream transcriptional responses to support lytic replication
- Toscana virus non-structural protein NSs acts as E3 ubiquitin ligase promoting RIG-I degradation
- A role of hypoxia-inducible factor 1 alpha in Mouse Gammaherpesvirus 68 (MHV68) lytic replication and reactivation from latency
- Molecular Anatomy of the Receptor Binding Module of a Bacteriophage Long Tail Fiber
- A Pseudomonas aeruginosa type VI secretion system regulated by CueR facilitates copper acquisition
- Dengue virus reduces AGPAT1 expression to alter phospholipids and enhance infection in Aedes aegypti
- Correction: Neutralization-guided design of HIV-1 envelope trimers with high affinity for the unmutated common ancestor of CH235 lineage CD4bs broadly neutralizing antibodies
- Dissemination of Chlamydia from the reproductive tract to the gastro-intestinal tract occurs in stages and relies on Chlamydia transport by host cells
- Dynamic organization of Herpesvirus glycoproteins on the viral envelope revealed by super-resolution microscopy
- RNA interference identifies domesticated viral genes involved in assembly and trafficking of virus-derived particles in ichneumonid wasps
- Novel cholinesterase paralogs of Schistosoma mansoni have perceived roles in cholinergic signaling and drug detoxification and are essential for parasite survival
- Novel RNA viruses associated with Plasmodium vivax in human malaria and Leucocytozoon parasites in avian disease
- Intra-host growth kinetics of dengue virus in the mosquito Aedes aegypti
- PDGFRA defines the mesenchymal stem cell Kaposi’s sarcoma progenitors by enabling KSHV oncogenesis in an angiogenic environment
- Re-assessing the diversity of negative strand RNA viruses in insects
- Novel replisome-associated proteins at cellular replication forks in EBV-transformed B lymphocytes
- Ecotin, a microbial inhibitor of serine proteases, blocks multiple complement dependent and independent microbicidal activities of human serum
- Transcriptional regulation of a gonococcal gene encoding a virulence factor (L-lactate permease)
- Resistance to ectromelia virus infection requires cGAS in bone marrow-derived cells which can be bypassed with cGAMP therapy
- Innate and adaptive immunity associated with resolution of acute woodchuck hepatitis virus infection in adult woodchucks
- Cross-talk between microglia and neurons regulates HIV latency
- PLOS Pathogens
- Archív čísel
- Aktuálne číslo
- Informácie o časopise
Najčítanejšie v tomto čísle
- Coxiella burnetii Type 4B Secretion System-dependent manipulation of endolysosomal maturation is required for bacterial growth
- IL-22 produced by type 3 innate lymphoid cells (ILC3s) reduces the mortality of type 2 diabetes mellitus (T2DM) mice infected with Mycobacterium tuberculosis
- The pandemic Escherichia coli sequence type 131 strain is acquired even in the absence of antibiotic exposure
- A role of hypoxia-inducible factor 1 alpha in Mouse Gammaherpesvirus 68 (MHV68) lytic replication and reactivation from latency